Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
... (UAGAUGAACUGA- GUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), siGENOME Non-Targeting siRNA Pool #1. Either HeLa c ells or 293T cells were transfected with siRNAs at ... Retrovirology 2011, 8:61. doi:10.1186/1742-4690-8-60 Cite this article as: Kula et al.: Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear...
Ngày tải lên: 13/08/2014, 01:21
Báo cáo y học: "Response to the commentary ‘Pooled indices to measure rheumatoid arthritis activity: a good reflection of the physician’s mind" pdf
... duration 10 years) and had previously failed to respond to aggressive therapy, as reflected by a failure to respond to a median of four disease-modifying antirheumatic drugs. Infliximab therapy was for ... initial protocol for our analysis was approved by the ethical committee in 2004. Thus, at the time of the study, the physicians were unaware that their behaviour would be...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Dialysis dose in acute kidney injury: no time for therapeutic nihilism – a critical appraisal of the Acute Renal Failure Trial Network study" ppt
... due to the nonsteady-state nature of the latter therapy. A physiologically logical approach to comparing the two modalities is the standardized urea Kt/V parameter, as described by Gotch [ 13] . This ... this randomization based on dose occurred, the actual dialysis treatment modality was determined by illness severity, as estimated by the cardiovascular component of th...
Ngày tải lên: 13/08/2014, 11:22
Báo cáo y học: " Differences in the ability to suppress interferon b production between allele A and allele B NS1 proteins from H10 influenza A viruses" pps
... b-actin mRNA: IFN-b forward 5’ GGCCATGACCAACAAGTGTCTCCTCC 3 and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3 , resulting a product of 550 bp; and b-actin forward 5’ TGGGTCAGAAGGACTCCTATG 3 and reverse 5’ ... were amplified using the primers NS1Kpn 5’ (5’-ATTCGGTACCAG- CAAAAGCAGGGTGACAAAG -3 )andNS1XhoI3’ (5’- TACCCTCGATAGAAACAAGGGTGTTTTTTAT -3 ). Twenty-five microliter PCR-mix contained 1x...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: " Mitogen-activated protein kinases and NFκB are involved in SP-A-enhanced responses of macrophages to " pdf
... of protein tyrosine kinases (PTKs) [9] that subsequently activate members of the STAT pathway, PI3K/Akt pathway and mitogen-activated protein (MAP) kinase family [10-12]. MAP kinases are a family ... demonstrated that SP -A enhances the ingestion and killing of K. pneumoniae [39 ] and mycoplasma [38 ] by macrophages. Recent work from our laboratory has shown that SP -A enhances...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: " GITR signaling potentiates airway hyperresponsiveness by enhancing Th2 cell activity in a mouse model of asthma" ppt
... citation purposes) Background Allergic asthma is an inflammatory disease characterized by reversible airway obstruction, and is associated with airways hyperresponsiveness (AHR) to bronchospas- mogenic ... Gras 1 , Betty CAM Van Esch 2 , Antoon JM Van Oosterhout* 1 and Martijn C Nawijn 1 Address: 1 Laboratory of Allergology and Pulmonary diseases, Department of Pathology and Medical...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: "Moxibustion and other acupuncture point stimulation methods to treat breech presentation: a systematic review of clinical trials" pptx
... meth- odological quality grade of a study. Data analysis Review Manager Software 4.2.7 provided by the Cochrane Collaboration was used for data analysis. Dichotomous data were expressed as a risk ratio (RR) ... respectively, and con- ducted study selection, data extraction and analysis, and quality assessment. XYW and HRZ performed the manual searches, data extraction and quality...
Ngày tải lên: 13/08/2014, 15:21
Báo cáo y học: "Gene expression response in target organ and whole blood varies as a function of target organ injury phenotype" ppsx
... addition, an enzymatic activity for the following proteins was measured: alanine aminotransferase, alkaline phosphatase, aspartate aminotransferase, lactate dehydroge- nase, and sorbitol dehydrogenase. ... the manufacturer's protocol. The amount and quality of the cRNA was assessed using a NanoDrop ND-1000 spectrophotometer and an Agilent Bioanalyzer. The cRNA was then frag...
Ngày tải lên: 14/08/2014, 20:22
Báo cáo y học: " Percentile benchmarks in patients with rheumatoid arthritis: Health Assessment Questionnaire as a quality indicator" pot
... were women and 89% were Caucasian; the median baseline age was 58.4 years and the median baseline HAQ-DI was 1. 13. Few patients were treated with biologics. The HAQ-DI values had a Gaussian distribution ... at baseline was 8.0 years, and the median base- line HAQ-DI was 1. 13. The mean (standard deviation) baseline HAQ-DI was 1.18 (0.79) units. The median test showed that the...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo y học: " Rapidly progressing, fatal and acute promyelocytic leukaemia that initially manifested as a painful third molar: a case report" potx
... laboratory data revealed dyslipi- daemia, hypoalbuminaemia and high levels of lactate dehydrogenase. An abdominal ultrasound revealed mild splenomegaly. During a short stay of three days in the internal ... showed pancytopaenia, delayed coagulation times, hypoalbuminaemia and elevated lactate dehydrogenase. Splenomegaly was detected on ultrasonography. Peripheral blood and bone marrow...
Ngày tải lên: 11/08/2014, 17:21