Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

... manuscript, and participated in the acquisi- tion of data. AZ participated in the coordination of the study. AAZ participated in the design of the study, and performed the statistical analysis. RA conceived ... production was enhanced by IL-4 and IL-5, and suggests a T-helper lymphocyte type 2 cytokine activation in response to sepsis after traumatic injury. Eosinophils normally a...
Ngày tải lên : 25/10/2012, 10:35
  • 10
  • 597
  • 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

... by unleashing NMDA and AMPA excitotoxic injury. Thus a mecha- nism by which abnormal energy metabolism may have an influence on clinical ALS is through depletion of Vgf neuroprotection against ... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamin...
Ngày tải lên : 03/11/2012, 10:52
  • 8
  • 499
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... similar to that in Asp141 of Met8P. The idea of NirF being a dehydrogenase is appealing because of the presence of a putative nucleotide-bind- ing motif in the N-terminal of the protein sequence and ... to seek accu- mulation of the substrate of NirF in a mutant that lacks NirF; this too is not trivial as the DnirF strain does not accumulate readily...
Ngày tải lên : 15/02/2014, 01:20
  • 12
  • 613
  • 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... features include dextrocardia, L-transposition of the great arteries, abdominal situs inversus, bilateral (a) t TCTCCCTCCA...
Ngày tải lên : 09/08/2014, 23:20
  • 36
  • 446
  • 0
Báo cáo y học: "Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer" pdf

Báo cáo y học: "Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer" pdf

... 1 Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer Wigard P Kloosterman, 1 Marlous Hoogstraat, 1,2 Oscar Paling, 2 Masoumeh Tavakoli-Yaraki, 1 ... tumor samples and found somatic mutations in 24 genes, including APC, KRAS, SMAD4 and PIK3CA. A pairwise comparison of somatic variations in...
Ngày tải lên : 09/08/2014, 23:20
  • 29
  • 405
  • 0
Báo cáo y học: "Computerized tomography myelography with coronal and oblique coronal view for diagnosis of nerve root avulsion in brachial plexus injury" potx

Báo cáo y học: "Computerized tomography myelography with coronal and oblique coronal view for diagnosis of nerve root avulsion in brachial plexus injury" potx

... article Computerized tomography myelography with coronal and oblique coronal view for diagnosis of nerve root avulsion in brachial plexus injury Hiroshi Yamazaki* 1 , Kazuteru Doi 2 , Yasunori Hattori 2 and ... Sensitivity and specificity for coronal and oblique coronal views of unrecognition of intradural ventral and dorsal nerve roo...
Ngày tải lên : 10/08/2014, 10:20
  • 5
  • 357
  • 0
Báo cáo y học: "Riding the knowledge translation roundabout: lessons learned from the Canadian Institutes of Health Research Summer Institute in knowledge translation" doc

Báo cáo y học: "Riding the knowledge translation roundabout: lessons learned from the Canadian Institutes of Health Research Summer Institute in knowledge translation" doc

... Science Open Access Meeting report Riding the knowledge translation roundabout: lessons learned from the Canadian Institutes of Health Research Summer Institute in knowledge translation Michelle ... Corresponding author Abstract Background: Funding the education and training of the next generation of health researchers is a key mandate of the...
Ngày tải lên : 11/08/2014, 05:21
  • 7
  • 374
  • 0
Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf

Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf

... lower antigen concen- trations and preferentially activated early in infec tion when antigen is limiting, and they initiate target cell lysis b etter than lower avidity T cells at any given anti- gen ... infection, contributing to containment of the acute viral burst and establishment of the prognostically-important persisting viral load. Understanding mechanisms that impair...
Ngày tải lên : 13/08/2014, 01:20
  • 13
  • 370
  • 0
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot

Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot

... Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan, 7 Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1-1 Murasaki-cho, Takatsuki, Osaka 569-1125, Japan, 8 Laboratory of Disease ... Hirofumi Akari 8 , Yoshio Koyanagi 9 , Jun Fujita 3 and Takashi Uchiyama 1 Address: 1 Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho...
Ngày tải lên : 13/08/2014, 05:21
  • 12
  • 692
  • 0
Báo cáo y học: "What is a virulence factor" pot

Báo cáo y học: "What is a virulence factor" pot

... bacterial virulence factor by itself to initiate disease. Finally, the importance of the O antigen and capsular polysaccharides as virulence determinants can be demon- strated by the fact that ... antibodies directed against the O antigens of Gram-negative bacteria are highly protective [7,8] and that many of the licensed vaccines against bacterial pathogens are directed against the capsu...
Ngày tải lên : 13/08/2014, 11:23
  • 2
  • 332
  • 0
Báo cáo y học: "Geographical information system and access to HIV testing, treatment and prevention of mother-to-child transmission in conflict affected Northern Uganda" pot

Báo cáo y học: "Geographical information system and access to HIV testing, treatment and prevention of mother-to-child transmission in conflict affected Northern Uganda" pot

... information system and access to HIV testing, treatment and prevention of mother -to- child transmission in conflict affected Northern Uganda Dick D Chamla* 1 , Olushayo Olu 2 , Jennifer Wanyana 3 , ... lowest utilizations of VCT, PMTCT and ART shown by this study is likely driven by the inadequacy of services and resources including stock-outs of med...
Ngày tải lên : 13/08/2014, 13:21
  • 9
  • 349
  • 0
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt

Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt

... Central Page 1 of 5 (page number not for citation purposes) Clinical and Molecular Allergy Open Access Research Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in ... that recent and recurrent episodes of acute chest syndrome are risk factors for cerebral vascular accidents [10]. Our findings of increased cerebr...
Ngày tải lên : 13/08/2014, 13:22
  • 5
  • 288
  • 0
Báo cáo y học: "Patients with allergic rhinitis and allergic asthma share the same pattern of eosinophil and neutrophil degranulation after allergen challenge" pdf

Báo cáo y học: "Patients with allergic rhinitis and allergic asthma share the same pattern of eosinophil and neutrophil degranulation after allergen challenge" pdf

... prime, eosinophils and neutrophils more or less to the same degree. The tendency that patients with allergic rhinitis and allergic asthma display the same pattern of degranu- lation of ECP and MPO ... Patients with allergic rhinitis and allergic asthma share the same pattern of eosinophil and neutrophil degranulation after aller...
Ngày tải lên : 13/08/2014, 13:22
  • 10
  • 477
  • 0
Báo cáo y học: "Sepsis is a major determinant of outcome in critically ill HIV/AIDS patients." pdf

Báo cáo y học: "Sepsis is a major determinant of outcome in critically ill HIV/AIDS patients." pdf

... Emergency Physicians; Canadian Critical Care Society; European Society of Clinical Microbiology and Infectious Diseases, et al: Surviving Sepsis Campaign: international guidelines for management of severe ... Committee. Statistical analysis Continuous variables were summarized as medians and interquartile ranges. We compared the distribution of continuous variables by using the t test,...
Ngày tải lên : 13/08/2014, 21:21
  • 8
  • 409
  • 0
Báo cáo y học: "Life is a Ponzi scheme" potx

Báo cáo y học: "Life is a Ponzi scheme" potx

... immigrants to Canada. The bank eventually failed because of bad real-estate loans - sounds familiar? - but Ponzi stayed on in Canada where eventually he was jailed for three years for check forgery. ... wasn't buying and selling postal reply coupons. In fact, he wasn't arbitraging anything. What he was actually doing was running what is called a pyramid scheme: as long as mone...
Ngày tải lên : 14/08/2014, 21:20
  • 4
  • 197
  • 0

Xem thêm