Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps

... where the introduced mutation in each case is u nderlined: 1) the mutant designated 61E/945-5 using primer 5’ - ACTAGTGTTGGATCCTAACAACGTTCGGCATG- G AGCTAGGTATAGCAGTAGCAAATATGGATG- TAAAACTACAGATAG-3’, ... 2) the mutant designated VRB3aa using primer 5’ -GAGGGAGTA ATCAGGA- CAATA GCTGCACAGGAAAATGCAACCCCC-3’,3) the mutant designated N147S using primer 5’-GGGAG- TAGTCAGGACAATA GCTGTGAGGG-3...

Ngày tải lên: 13/08/2014, 01:20

... of a core protein with covalently attached gly- cosaminoglycans chains, especially heparan sulfate. The glycosaminoglycans, comprised of alternating disacchar - ide units of uronic acid and amino ... proteoglycans/Heparan sulfate 1.2.1 Heparan sulfate proteoglycans/Heparan sulfate and HPV binding Cell surface heparan sulfate proteoglycans (HSPGs), mainly syndecans and glypican...

Ngày tải lên: 12/08/2014, 04:21

... secondary antibody alone. Staining with the anti-carboxy terminal Glut-1 polyclonal antibody (generously provided by A. Carruthers) was per- formed following intracellular staining by fixation (Cytofix ... 197(4):475-487. 28. Barata JT, Boussiotis VA, Yunes JA, Ferrando AA, Moreau LA, Veiga JP, Sallan SE, Look AT, Nadler LM, Cardoso AA: IL-7-dependent human leukemia T-cell line as a...

Ngày tải lên: 13/08/2014, 09:21

... 5'-agtgcaaagtctttgacgccttgctgaatctgagc-3' R: 5'-gctcagattcagcaaggcgtcaaagactttgcact-3' 188-190 RKT [R/K]X[pS/pT] PKA A5 68T F: 5'-tgttcctgtccccgaaaatcaacctcttacccaac-3' ... F:5'-ttcctgtccccgaaaaacagactcttacccaacaccaagg-3' R:5'-ccttggtgttgggtaagagtctgtttttcggggacaggaa-3' 189-192 KTTS KXX[pS/pT] PKA A5 68G_C56 9A_ A570C_ A5 71G_C57 2A...

Ngày tải lên: 03/11/2012, 11:17

... biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase Tadayoshi Kanao, Toshiaki Fukui, Haruyuki Atomi and Tadayuki Imanaka Department of Synthetic Chemistry and Biological ... play a vital role in providing acetyl-CoA and oxaloacetate in the cytosol as starting materials for a variety of biosynthetic pathways. Rat and human ACLs from various organs an...

Ngày tải lên: 08/03/2014, 22:20

... Goulard 1 and Sylvie Rebuffat 1 1 Laboratory of Chemistry and Biochemistry of Natural Substances, Department of Regulation, Development and Molecular Diversity, National Museum of Natural History, ... current study, we have studied the conformation and the antibacterial activity of microcin J25 variants that lack the macrocyclic backbone of the native peptide. Among t...

Ngày tải lên: 23/03/2014, 21:20

... study and participated in its study and coordination. Both authors read and approved the final manuscript. References 1. Hamoda H, Osser DN: The psychopharmacology algorithm project at the Harvard ... is a clinical subtype of major depressive disorder. A number of clinical studies have demonstrated the efficacy of the combination of an antidepressant (for example, a tr...

Ngày tải lên: 08/08/2014, 23:21

... by OVX and by arthritis Flow cytometry analysis was performed to evaluate the effects of OVX and arthritis on phenotypes of bone marrow lymphocytes (Table 2). OVX was associated with an increased number ... Trabecular bone mineral density (BMD) was determined with a metaphyseal scan at a point 3% of the length of the femur from the growth plate and the inner 45% o...

Ngày tải lên: 09/08/2014, 06:23

... respectively. As in the human sequence, an additional putative WT1 binding site was Northern blot analysis of HeLa cell and WCCS-1 mRNAFigure 2 Northern blot analysis of HeLa cell and WCCS-1 mRNA. A ... oligonucleotides (5'GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUG GCUUUGAUGAAA3') was ligated to the CIP/TAP treated 5' RNA end using T4 ligase. cDNA was generated using random...

Ngày tải lên: 11/08/2014, 08:20

... Charalambos Charalambides Address: Department of Trauma & Orthopaedics, The Whittington University Hospital, London, UK Email: Mudussar A Ahmad* - mudussarahmad@hotmail.com; Damayanthi Kuhanendran ... Case Reports Open Access Case report Accelerated tibial fracture union in the third trimester of pregnancy: a case report Mudussar A Ahmad*, Damayanthi Kuhanendran, Irvine W...

Ngày tải lên: 11/08/2014, 11:20