Báo cáo y học: "The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop " doc

Báo cáo y học: "The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop." doc

Báo cáo y học: "The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop." doc

... Retrovirology 2010, 7:113 http://www.retrovirology.com/content/7/1/113 Page 6 of 10 REVIE W Open Access The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop Jonathan ... al.: The xenotropic murine leukemia virus- related retrovirus debate continues at first international workshop. Retrovirology 2010...

Ngày tải lên: 13/08/2014, 01:20

10 244 0
Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

... type 1 322:TCCGCCGAATGGCCAACTTTCAATGTAGGATGGCCTCAGGATGGTACTTTCAATTTAAGTATTATCCCTCAGGTTAAGTCTAGAGTGTTTTGTCATGGTCCCCACGG 428 C FS type 2 322:TCCGCCGAATGGCCAACTTTCAATGTAGGATGGCCTCAGGATGGTACTTTCAATTTAAGTATTATCCCTCAGGTTAAGTCTAGAGTGTTTTGTCATGGTCCCCACGG ... 321:TCCGCCGAATGGCCAACTTTCAATGTGGGATGGCCTCAGGATGGTACTTTCAATTTAAGTATTATCTCTCAGGTTAAGTCTAGAGTGTTTTGTCCTGGTCCCCACGG 427 P mERV Chr 7 321:TCCGCTGAATG...

Ngày tải lên: 13/08/2014, 01:20

7 349 0
Báo cáo y học: "The active metabolite of leflunomide, A77 1726, interferes with dendritic cell function" doc

Báo cáo y học: "The active metabolite of leflunomide, A77 1726, interferes with dendritic cell function" doc

... cells DCs are typically characterized by their ability to produce large amounts of predominantly T-cell modulatory cytokines [26]. Analyzing cytokine production of cells that were differentiated and ... during maturation of immature DCs leads to a differentially affected phenotypeTreatment with LEF-M during maturation of immature DCs leads to a differentially affected phenotype. Monocytes we...

Ngày tải lên: 09/08/2014, 06:22

10 389 0
Báo cáo y học: "The p38 mitogen-activated protein kinase signaling cascade in CD4 T cells" docx

Báo cáo y học: "The p38 mitogen-activated protein kinase signaling cascade in CD4 T cells" docx

... the induction of IL-4 by phorbol 12-myristate 13-acetate and ionomycin or of IL-5 and IL-13 by phorbol 12-myristate 13- acetate and dibutyryl cAMP was partly abrogated by SB203580 [59,66]. In murine splenic ... vertebrates can also be phosphorylated at a serine residue [77]. Stimulation by IL-12, for example, induces STAT4 phosphorylation at both tyrosine and serine residues. Serine pho...

Ngày tải lên: 09/08/2014, 07:20

11 413 0
Báo cáo y học: "The role of traditional healers in tooth extractions in Lekie Division, Cameroon" docx

Báo cáo y học: "The role of traditional healers in tooth extractions in Lekie Division, Cameroon" docx

... fact that treatments offered by TH are cheap and that they are easier to access, most patients confirm ed that they visited TH because their treatments were painless and faster. This has a psychological ... impact on the patients [41] as anticipated pain during dental treatment causes anxiety. It has been found that patients with high dental anxiety are likely t o have exaggerated memory and...

Ngày tải lên: 10/08/2014, 09:21

8 503 0
Báo cáo y học: " The role of tibialis posterior fatigue on foot kinematics during walking Research" doc

Báo cáo y học: " The role of tibialis posterior fatigue on foot kinematics during walking Research" doc

... study was to investigate the effect of localised tibialis posterior muscle fatigue on foot kinematics during walking. It was hypothesised that following fatigue, subjects would demonstrate greater ... Correspondence: mbpohl@ucalgary.ca 1 Running Injury Clinic, Faculty of Kinesiology, University of Calgary, Calgary, AB, Canada Full list of author information is available at the end of the...

Ngày tải lên: 10/08/2014, 21:24

8 300 0
Báo cáo y học: "The effect of tiotropium therapy on markers of elastin degradation in COPD" doc

Báo cáo y học: "The effect of tiotropium therapy on markers of elastin degradation in COPD" doc

... before the study. One patient with alpha-1 antitrypsin deficiency had never smoked. Two patients had homozygous-Z phenotype alpha-one antitrypsin deficiency (ATTD). Patients were categorized as ... and therefore may be an indication of stimulation of neu- trophils and macrophages by a heightened inflammatory state of patients with COPD as indicated by increased inflammatory markers detected i...

Ngày tải lên: 12/08/2014, 14:20

7 395 0
Báo cáo y học: " The role of endothelin-1 in hyperoxia-induced lung injury in mice" docx

Báo cáo y học: " The role of endothelin-1 in hyperoxia-induced lung injury in mice" docx

... study yield evidence of the involvement of ET-1 in the lung function changes induced by hyperoxia. The highly dissociated effects of oxygen toxicity on the airway and tissue mechanics dem- onstrate ... calculation of the total respiratory system resistances at the breathing fre- quency (Rrs = Raw + G/ωα, where ω = 4π at 2 Hz and α = 2/π arctan [H/G]) in Fig. 3 may lead to misinterpretatio...

Ngày tải lên: 12/08/2014, 16:20

10 327 0
Báo cáo y học: "The Hoover''''s Sign of Pulmonary Disease: Molecular Basis and Clinical Relevance" docx

Báo cáo y học: "The Hoover''''s Sign of Pulmonary Disease: Molecular Basis and Clinical Relevance" docx

... of severe airway obstruction. While readily recognizable at the bedside, it may easily be missed on a cursory physical examination. Hoover's sign refers to the inspiratory retraction of ... In a multivariate analysis, severity of dyspnea, the patient's body mass index, numbers of exacerbations historically and numbers of prescribed drugs were independently associated with the ......

Ngày tải lên: 13/08/2014, 13:22

5 374 0
Báo cáo y học: "The Pediatric Obsessive-Compulsive Disorder Treatment Study II: rationale, design and methods" docx

Báo cáo y học: "The Pediatric Obsessive-Compulsive Disorder Treatment Study II: rationale, design and methods" docx

... types of treatment (inpatient treatment, out- patient treatment, medication, other treatment costs). The increase in costs for inpatient treatment for hyperkinetic disorder may be explained by ... adolescents treated for hyperkinetic disorder decreases dramatically with age [41], the great majority of patients on medication are in the age group < 15 years, with only a very small number ......

Ngày tải lên: 13/08/2014, 18:21

7 248 0
Từ khóa:
w