Báo cáo y học: "The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop " doc
Báo cáo y học: "The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop." doc
... Retrovirology 2010, 7:113
http://www.retrovirology.com/content/7/1/113
Page 6 of 10
REVIE W Open Access
The xenotropic murine leukemia virus-related
retrovirus debate continues at first international
workshop
Jonathan ... al.: The xenotropic murine leukemia virus-
related retrovirus debate continues at first international workshop.
Retrovirology 2010...
Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx
... type 1 322:TCCGCCGAATGGCCAACTTTCAATGTAGGATGGCCTCAGGATGGTACTTTCAATTTAAGTATTATCCCTCAGGTTAAGTCTAGAGTGTTTTGTCATGGTCCCCACGG 428
C
FS type 2 322:TCCGCCGAATGGCCAACTTTCAATGTAGGATGGCCTCAGGATGGTACTTTCAATTTAAGTATTATCCCTCAGGTTAAGTCTAGAGTGTTTTGTCATGGTCCCCACGG ... 321:TCCGCCGAATGGCCAACTTTCAATGTGGGATGGCCTCAGGATGGTACTTTCAATTTAAGTATTATCTCTCAGGTTAAGTCTAGAGTGTTTTGTCCTGGTCCCCACGG 427
P
mERV Chr 7 321:TCCGCTGAATG...
Báo cáo y học: "The active metabolite of leflunomide, A77 1726, interferes with dendritic cell function" doc
...
cells
DCs are typically characterized by their ability to produce large
amounts of predominantly T-cell modulatory cytokines [26].
Analyzing cytokine production of cells that were differentiated
and ... during maturation of immature DCs leads to a differentially affected phenotypeTreatment with LEF-M during maturation of immature DCs leads to a differentially affected phenotype. Monocytes we...
Báo cáo y học: "The p38 mitogen-activated protein kinase signaling cascade in CD4 T cells" docx
... the
induction of IL-4 by phorbol 12-myristate 13-acetate and
ionomycin or of IL-5 and IL-13 by phorbol 12-myristate 13-
acetate and dibutyryl cAMP was partly abrogated by
SB203580 [59,66]. In murine splenic ... vertebrates can
also be phosphorylated at a serine residue [77]. Stimulation
by IL-12, for example, induces STAT4 phosphorylation at
both tyrosine and serine residues. Serine pho...
Báo cáo y học: "The role of traditional healers in tooth extractions in Lekie Division, Cameroon" docx
... fact that treatments offered by TH are
cheap and that they are easier to access, most patients
confirm ed that they visited TH because their treatments
were painless and faster. This has a psychological ... impact
on the patients [41] as anticipated pain during dental
treatment causes anxiety. It has been found that patients
with high dental anxiety are likely t o have exaggerated
memory and...
Báo cáo y học: " The role of tibialis posterior fatigue on foot kinematics during walking Research" doc
... study was to investigate the effect of localised tibialis posterior muscle fatigue on
foot kinematics during walking. It was hypothesised that following fatigue, subjects would demonstrate greater ... Correspondence: mbpohl@ucalgary.ca
1
Running Injury Clinic, Faculty of Kinesiology, University of Calgary, Calgary, AB,
Canada
Full list of author information is available at the end of the...
Báo cáo y học: "The effect of tiotropium therapy on markers of elastin degradation in COPD" doc
... before the study. One
patient with alpha-1 antitrypsin deficiency had never
smoked. Two patients had homozygous-Z phenotype
alpha-one antitrypsin deficiency (ATTD). Patients were
categorized as ... and
therefore may be an indication of stimulation of neu-
trophils and macrophages by a heightened inflammatory
state of patients with COPD as indicated by increased
inflammatory markers detected i...
Báo cáo y học: " The role of endothelin-1 in hyperoxia-induced lung injury in mice" docx
... study yield evidence
of the involvement of ET-1 in the lung function changes
induced by hyperoxia. The highly dissociated effects of
oxygen toxicity on the airway and tissue mechanics dem-
onstrate ... calculation of the
total respiratory system resistances at the breathing fre-
quency (Rrs = Raw + G/ωα, where ω = 4π at 2 Hz and α =
2/π arctan [H/G]) in Fig. 3 may lead to misinterpretatio...
Báo cáo y học: "The Hoover''''s Sign of Pulmonary Disease: Molecular Basis and Clinical Relevance" docx
... of severe airway
obstruction. While readily recognizable at the bedside, it may easily be missed on a cursory physical
examination. Hoover's sign refers to the inspiratory retraction of ... In a
multivariate analysis, severity of dyspnea, the patient's
body mass index, numbers of exacerbations historically
and numbers of prescribed drugs were independently
associated with the ......
Báo cáo y học: "The Pediatric Obsessive-Compulsive Disorder Treatment Study II: rationale, design and methods" docx
... types of treatment (inpatient treatment, out-
patient treatment, medication, other treatment costs). The
increase in costs for inpatient treatment for hyperkinetic
disorder may be explained by ... adolescents
treated for hyperkinetic disorder decreases dramatically
with age [41], the great majority of patients on medication
are in the age group < 15 years, with only a very small
number ......
Từ khóa: