Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

... 204 ******************************************************************** Contaminant 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAAAAAAAGGGCAAGAACATTTGAC 272 PmERV Chr 7 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAGAAAAAGGGCAAGAACATTTGAC 272 ********************************************* ... 642:CCTGATAGCGGCGGACCCCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACAGAGCACAACCCTCCTCCTCTGCCAGGGAGAAC...
Ngày tải lên : 13/08/2014, 01:20
  • 7
  • 349
  • 0
Báo cáo y học: "The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop." doc

Báo cáo y học: "The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop." doc

... DNA contamination, methods of sample hand- ling and storage, use of antiretrovirals currently available for HIV therapy, and progress in developing standard PCR and serological reagents. In his ... is clearly an important issue if developing antiviral strategies becomes a priority. Although the XMRV field is in its infancy, E. Sparger (University of California at Davis, Califo...
Ngày tải lên : 13/08/2014, 01:20
  • 10
  • 244
  • 0
Báo cáo y học: "An open pilot study of zonisamide augmentation in major depressive patients not responding to a low dose trial with duloxetine: preliminary results on tolerability and clinical effects" ppsx

Báo cáo y học: "An open pilot study of zonisamide augmentation in major depressive patients not responding to a low dose trial with duloxetine: preliminary results on tolerability and clinical effects" ppsx

... to receiving zonisamide augmentation. ASEX = Arizona Sexual Experience Scale; HAM -A = Hamilton Anxiety Scale; HAM-D = Hamilton Depression Scale; YMRS = Young Mania Rating Scale. Fornaro et al. Annals of ... recording. Patients could leave the study at any time and still obtain clinical care. Study procedures and efficacy measures Diagnosesweremadebyclinicalexaminationandthe Structured Clini...
Ngày tải lên : 09/08/2014, 01:21
  • 8
  • 560
  • 0
Báo cáo y học: "An integrated assessment of wild vegetable resources in Inner Mongolian Autonomous Region" ppsx

Báo cáo y học: "An integrated assessment of wild vegetable resources in Inner Mongolian Autonomous Region" ppsx

... China’s total land area. Inner Mongo- lia’ s geography varies considerably from plateau to mountains, upland, plains, basin and desert. The average altitude is about 1000 m, and consists mostly ... Polygonum aviculare L., Potentilla anserina L., Potentilla anserina L., Platycodon grandiflorus (Jacq.) A. DC., and Vicia amoena Fisch The remaining species are still fully wild and have not yet...
Ngày tải lên : 10/08/2014, 09:21
  • 8
  • 477
  • 0
Báo cáo y học: "An N-terminally truncated envelope protein encoded by a human" ppt

Báo cáo y học: "An N-terminally truncated envelope protein encoded by a human" ppt

... experiments of placental tissue with mAb 6A2 B2 and anti-Syncytin-1 pAb both antibodies revealed different staining patterns. Staining with anti-Syncytin-1 pAb was most prominent at the syncytiotrophoblast ... 399 :A4 0 -A4 7. 2. Komurian-Pradel F, Paranhos-Baccala G, Bedin F, Ounanian-Paraz A, Sodoyer M, Ott C, Rajoharison A, Garcia E, Mallet F, Mandrand B, Perron H: Molecular cloning and...
Ngày tải lên : 13/08/2014, 01:20
  • 14
  • 166
  • 0
Báo cáo y học: "Human T-cell leukemia virus type 2 post-transcriptional control protein p28 is required for viral infectivity and persistence in vivo" ppt

Báo cáo y học: "Human T-cell leukemia virus type 2 post-transcriptional control protein p28 is required for viral infectivity and persistence in vivo" ppt

... lymphocyte malignancy, and various lym- phocyte-mediated inflammatory diseases such as HTLV-1 associated myelopathy/tropical spastic paraparesis (HAM/TSP) [4-7]. However, only a few cases of atypical hairy ... control. Proteins were visualized using the ECL western blotting analysis system (Santa Cruz Biotechnology, Santa Cruz, CA). DNA isolation, standard PCR, and Taqman real-time PCR...
Ngày tải lên : 13/08/2014, 05:20
  • 11
  • 277
  • 0
Báo cáo y học: " Human endogenous retrovirus HERV-K(HML-2) encodes a stable signal peptide with biological properties distinct from Rec" pps

Báo cáo y học: " Human endogenous retrovirus HERV-K(HML-2) encodes a stable signal peptide with biological properties distinct from Rec" pps

... kindly provided by Bryan Cullen. pEGFP-N1 (Clontech) was used as control for transfection efficiency and for normalization in the CAT assay. Antibodies A rabbit anti-SP antibody was raised against ... analyzed by Western blotting using anti-SP. Cellular β-actin was analyzed as a loading control. Larger-sized protein bands, including the protein band slightly larger than SP in...
Ngày tải lên : 13/08/2014, 05:21
  • 20
  • 250
  • 0
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

... cphA:forward,GCGATA CCATGG TATCCGAATTCCAAG and reverse, ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; ... CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB:forward,GCGATA GAATTC ATG ACGAATTGCGATCGCGA and reverse, ACCCGG GTCGACTCAGTGATGGTGGTGATGGTGTTTGAC CT...
Ngày tải lên : 08/03/2014, 23:20
  • 10
  • 499
  • 0
Báo cáo hóa học: " An Approach to Optimum Joint Beamforming Design in a MIMO-OFDM Multiuser System" potx

Báo cáo hóa học: " An Approach to Optimum Joint Beamforming Design in a MIMO-OFDM Multiuser System" potx

... varying so that the transmitter can have an accurate channel estimate by means of a feedback channel, for example. Currently, there are several standards in which this assumption is valid. Among ... speed and the fact that local suboptimum designs may be found. Be- sides, GS and AM cannot always include every kind of con- straint, whereas in SA this can be easily done by using ade...
Ngày tải lên : 23/06/2014, 00:20
  • 12
  • 292
  • 0
Báo cáo y học: "Hospital Anxiety and Depression Scale (HADS): validation in a Greek general hospital sample" pdf

Báo cáo y học: "Hospital Anxiety and Depression Scale (HADS): validation in a Greek general hospital sample" pdf

... Georgia Kalemi - yanmih@yahoo.com; Katerina Fineti - kfineti@yahoo.com; Paulos Patapis - gchclin@med.uoa.gr; Konstantinos Protopapas - kprotopapas@hotmail.com; Lefteris Lykouras* - panpsyclin@attikonhospital.gr * ... Psychiatry Open Access Primary research Hospital Anxiety and Depression Scale (HADS): validation in a Greek general hospital sample Ioannis Michopoulos †1 , Athanasios Dou...
Ngày tải lên : 08/08/2014, 23:20
  • 5
  • 532
  • 0