Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

... CTACCAAGCC TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAA- TAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCT- TAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAG- TTTTTGCTGTACGTACAGCAAAAACTATT ... GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAG- TTTTTGCTGTACGTACAGCAAAAACTATT CTTA- AT GCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTA...

Ngày tải lên: 13/08/2014, 01:20

12 337 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

... of some arylamide substrates docked in the active site of penicillin acylase by AM1 calculations. Amino acid residues of the enzyme are at their X-ray coordinates [19]. Substrates having local ... identified by their melting point, elemental analysis and 1 H-NMR spectra. In the case of phenylacetamido-benzoic acids and phenylacetyl-4-methylcoumaryl-7-amide the melting point...

Ngày tải lên: 16/03/2014, 16:20

8 439 0
Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

... details 1 Department of Human Anatomy and Physiology, University of Padova, Italy. 2 Department of Neuroscience, University of Padova, Italy. 3 Department of Pharmaceutical Sciences, University of Parma, Italy. 4 Department ... BoHV-4 was injected into a tumour grown in rat brain. Although virus expression was scattered across the tumour mass, it was mainly located in the...

Ngày tải lên: 12/08/2014, 02:20

6 232 0
Báo cáo y học: " Proinflammatory cytokine responses induced by influenza A (H5N1) viruses in primary human alveolar and bronchial epithelial cells" ppt

Báo cáo y học: " Proinflammatory cytokine responses induced by influenza A (H5N1) viruses in primary human alveolar and bronchial epithelial cells" ppt

... Kobasa D, Takada A, Shinya K, Hatta M, Halfmann P, Theriault S, Suzuki H, Nishimura H, Mitamura K, Sugaya N, Usui T, Murata T, Maeda Y, Watanabe S, Suresh M, Suzuki T, Suzuki Y, Feldmann H, Kawaoka ... viruses also act via TLR-3 signaling in primary human epithelial cells. Cytokine and chemokine responses in vivo result from autocrine and paracrine interactions involving many cell type...

Ngày tải lên: 12/08/2014, 18:20

13 214 0
Báo cáo y học: " Decompressive laparotomy for abdominal compartment syndrome – a critical analysis" pps

Báo cáo y học: " Decompressive laparotomy for abdominal compartment syndrome – a critical analysis" pps

... especially in trauma patients who are often severely coagulopathic early after arrival in the ICU. Hemorrhagic shock was the cause of death in a third of the deaths after DL in the paper by Ertel and ... analysis based on patients already described in another paper that was included in the analysis (n = 1), indica- tion for laparotomy planned for reasons other than...

Ngày tải lên: 12/08/2014, 23:23

9 302 0
Báo cáo y học: "Transpulmonary thermodilution using femoral indicator injection: a prospective trial in patients with a femoral and a jugular central venous catheter" ppt

Báo cáo y học: "Transpulmonary thermodilution using femoral indicator injection: a prospective trial in patients with a femoral and a jugular central venous catheter" ppt

... and the tip of the arterial TPTD detection site. Injection of the indi- cator in the distal inferior vena cava adds the volume of the inferior vena cava to the total volume participating in thermodilution, ... 25 May 2010 References 1. Atabai K, Matthay MA: The pulmonary physician in critical care. 5: Acute lung injury and the acute respiratory distress syndrom...

Ngày tải lên: 13/08/2014, 20:22

10 291 0
Báo cáo y học: "Bench-to-bedside review: Circulating microparticles - a new player in sepsis" ppt

Báo cáo y học: "Bench-to-bedside review: Circulating microparticles - a new player in sepsis" ppt

... gamma- carboxyl groups of vitamin-K-dependent factors and phosphatidylserine comprise the key step in this assembly, explaining the effi cacy of anti-vitamin K treatments in hypercoagulable states ... quantitative changes that could play a pathophysiological role in in ammatory diseases. Microparticles may participate in the pathogenesis of sepsis through multiple w...

Ngày tải lên: 13/08/2014, 21:21

8 327 0
Báo cáo hóa học: " Homologous recombination is unlikely to play a major role in influenza B virus evolution" doc

Báo cáo hóa học: " Homologous recombination is unlikely to play a major role in influenza B virus evolution" doc

... To gain an initial insight into possible recombination events, each of the eight data sets was analyzed respectively using the 3SEQ [13], the Chi- maera [14], and the RDP [15] methods, which are ... topological shifts for each of the recombinants have strong bootstrap support (data not shown). However, large influenza viral genes in the databases may actually represent assem...

Ngày tải lên: 20/06/2014, 01:20

3 282 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

... possible that feedback inhibition of the GDP -a- D -mannose 4,6-dehydratase occurs via the GDP- 6-deoxy- D -talose pathway in A. actinomycetemcomitans SUNYaB 75. In the enzyme assay using the purified His 6 -tagged ... regardless of the addition of the proteins. The peak that appeared at 24.0 min was in agreement with that of authentic NADP + . The reason why t...

Ngày tải lên: 17/03/2014, 10:20

9 626 0
w