Báo cáo y học: " Relative replication capacity of phenotypic SIV variants during primary infections differs with route of inoculatio" doc

... significantly shorter in the CCI rats compared with sham controls. Mechanical allodynia and thermal hyperalgesia in- duced by CCI was attenuated by intrathecal adminis- tration with TLR4 -siRNA (p<0.05, ... Conclusions/Significance: These findings suggest that suppression of TLR4 mediated by intrathecally administered siRNA may be a new strategy for the treatment of neuro...

Ngày tải lên: 25/10/2012, 11:48

... oligonucleotides: 5Â-GGTTA TATTGCCAAGAACTATAACTGTGCATAC-3Â,5Â-C ATTGTTTAAAAATCTCCTCAGGCTGCGACACTTT A- 3Â,and5Â-ACGAGTGGCCACTGCGGACATAAATC TGGACACGGAAGTGCCTGCTGG-3Â, respectively. Production of recombinant ... displays de novo electrophysiological properties similar to those of a- like toxins Balkiss Bouhaouala-Zahar 1 , Rym Benkhalifa 1 , Najet Srairi 1 , Ilhem Zenouak...

Ngày tải lên: 08/03/2014, 23:20

... J. Biochem. 269) Ó FEBS 2002 Irregular spiking in free calcium concentration in single, human platelets Regulation by modulation of the inositol trisphosphate receptors Roosje M. A. van Gorp 1 , ... On the other hand, the sulfhydryl reagent thimerosal elicits [ Ca 2+ ] i spiking not by increasing the InsP 3 level but by potentiating InsP 3 rece...

Ngày tải lên: 17/03/2014, 17:20

... indicators for sensor proteins such as ArcB, BvgS and EvgS. As the quinones are the only components of the respiratory chain which apparently are free in their movement within the membrane, they ... histidine kinases may either be the consequence of a decrease in the histidine kinase activity, or, alternatively, of an increase in an intrinsic autophosphatase...

Ngày tải lên: 17/03/2014, 23:20

... Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease? Annals of General Psychiatry 2011 10:16. Submit your next manuscript to BioMed Central and take full advantage ... may further contribute to alterations of C 3a and C 5a levels bypassing the tradi- tional complement activation cascade. There are few reports on...

Ngày tải lên: 09/08/2014, 01:21

Ngày tải lên: 09/08/2014, 01:22

... article Cortisol and hypothalamic–pituitary–gonadal axis hormones in follicular-phase women with fibromyalgia and chronic fatigue syndrome and effect of depressive symptoms on these hormones Ali Gur 1 , ... fibromyalgia and CFS. Early investiga- tions postulated hypofunction of the HPA axis in these conditions, based on the finding of...

Ngày tải lên: 09/08/2014, 01:23

... we may obtain an insight into the pathogenesis of H9N2 viruses in humans. To examine the replication efficiency of the H9N2 virus in human cells, A549 cells were infected with H9N2/ G1, H9N2 /Y2 80 ... translation of viral protein but not in the infectivity or transcription of viral genes of these H9N2 viruses in the infected cells. This difference may p...

Ngày tải lên: 12/08/2014, 04:20

... tissue-type plasminogen activator; TNF: tumor necrosis factor; u-PA: urokinase-type plasminogen activator; u-PA -/- : urokinase-type plasminogen activator gene deficient; u-PAR: urokinase-type plasminogen ... 12:R37 http:/ /arthritis- research.com/content/12/2/R37 Page 12 of 13 RESEA R C H ARTIC L E Open Access Urokinase-type plasminogen activator and arthritis progressi...

Ngày tải lên: 12/08/2014, 11:23

... cited. Research article Natural killer cells control a T-helper 1 response in patients with Behỗet's disease Yukie Yamaguchi 1, 2 , Hayato Takahashi 3 , Takashi Satoh 1 , Yuka Okazaki 1 , Nobuhisa ... cytokine predominance. J Allergy Clin Immunol 2005, 11 5:8 41- 847. 15 . Takahashi H, Amagai M, Tanikawa A, Suzuki S, Ikeda Y, Nishikawa T, Kawakami Y, Kuwa...

Ngày tải lên: 12/08/2014, 12:20

... 5 of 15 RESEARCH ARTICLE Open Access Relative percentage and zonal distribution of mesenchymal progenitor cells in human osteoarthritic and normal cartilage David Pretzel 1,2* , Stefanie Linss 1 , ... further analyzed. Zonal distribution of CD166 + mesenchymal progenitor cells in the cartilage matrix CD166 + chondrocytes were almost exclusively locat...

Ngày tải lên: 12/08/2014, 15:23

... of the genetic diversity of milk virus suggested a difference in the dominant virus species in milk and peripheral blood [4]. A second study subsequently reported that the predominant virus in ... JB, Letvin NL: Potent simian immunodeficiency virus- specific cellular immune responses in the breast milk of simian immunodeficiency virus- infected,...

Ngày tải lên: 12/08/2014, 23:22

... 7:88 http://www.retrovirology.com/content/7/1/88 Page 8 of 12 RESEARC H Open Access Relative replication capacity of phenotypic SIV variants during primary infections differs with route of inoculation Tasha ... capacity of phenotypic SIV variants during primary infections differs with route of inoculation. Retrovirology 2010 7:88. Submit...

Ngày tải lên: 13/08/2014, 01:20

... range of the joint. Activator Instrument An Activator IV instrument was applied with the patient prone and with a setting of 1 for the Atlas and 2 for the cervical and upper thoracic segments. Participants received ... Therapy and Clinical Application. Austin, Pro-Ed 2001. 91. McPartlan JM, Simons DG: Myofascial trigger points: Translating molecular theor...

Ngày tải lên: 13/08/2014, 14:20