... International Publisher. All rights reserved Research Paper A < /b> Novel < /b> Variable < /b> Number < /b> of < /b> Tandem < /b> Repeat < /b> of < /b> the < /b> Natriuretic < /b> Peptide < /b> Precursor < /b> B gene’s 5’-Flanking Region is Associated with Essential ... in the < /b> Framingham Heart Study. Hypertension. 2003; 41: 978-83. 23. Nakamura Y,< /b...
Ngày tải lên: 26/10/2012, 10:04
... 4. (A) Proposed pathway of 4-amino-3-hydroxybenzoate cleavage in Bordetella sp. strain 10d and (B) comparison to the modified meta- cleavage pathway of 2-aminophenol in Pseudomonas sp. AP-3. (A) Proposed ... 4-Amino-3-hydroxybenzoate 2,3 -dioxygenase (Eur. J. Biochem. 269) 5873 A novel meta -cleavage dioxygenase that cleaves a carboxyl-group- substituted 2...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: A novel, inducible, citral lyase purified from spores of Penicillium digitatum docx
... enzymatic equivalent of this reaction the actions of a hydratase and an aldolase are needed. Citral lyase of P. digitatum combines hydratase and aldolase activity in a single enzyme. No other enzyme ... and average spore size did not change during induction. Stability of citral lyase activity The activity and stability of citral lyase was dramatically affected by t...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo Y học: A novel gain-of-function mutation of the integrin a2 VWFA domain docx
... W, 5Â-TTCAATGTGTCTGATTGGGCAGCTCTACTAGA AAAGGCTG-3Â; for E318 to I, 5Â-CAATGTGTCTGA TATAGCAGCTCTACTAGAAAAG-3Â; for E318 to R, 5Â-CAATGTGTCTGATCGAGCAGCTCTACTAGAAA AG-3Â; for E318 to Y, 5Â-CAATGTGTCTGATTATGCA GCTCTACTAGAAAAG-3Â. ... site of a2 b1 is located in the 200 amino acid v on Willebrand Factor type A domain (VWFA domain, also known a s the A- or I -domain) of t he a...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx
... similarity with other known DNA repair enzymes could be found in the databases, suggesting that these proteins may represent a novel family of DNA repair enzymes. Moreover, searches against domain databases (Pfam, ... DNA repair enzyme) for consis- tency with the Arabidopsis thaliana enzyme, belongs to a large family of proteins containing RNA recognition motifs...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo hóa học: " Caveolin-1 interacts with the Gag precursor of murine leukaemia virus and modulates virus production" docx
... retrovi- ruses. Caveolin-1 interacts with Gag precursor of MLV Gag- Cav-1 co-localization, the presence of the putative CBD in MA of MLV and the high degree of conservation among γ-retroviruses motivated ... in the MA of MoMLV and A-MLV Gag precursors (Table 1) [19]. Strikingly, the motif is highly conserved within most γ-ret- roviruses (Table 1) and is...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: " A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14- Peripheral Blood Mononuclear Cell" potx
... src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAA94AAAWQCAIAAAAjjQtaAAAACXBIWXMAABYlAAAWJQFJUiTwAAAYCUlEQVR42uzYMRUAIAxDQcqMTVzhNV3w0OVOQqb/Uue+BQAATNsmAAAAaQ4AAHyVxAoAADDOaw4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAABIcwAAkOYAAIA0BwAAaQ4AAEhzAACQ5gAA...
Ngày tải lên: 08/08/2014, 18:20
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx
... appear to play key roles in the pathogenesis of RA, and the co-ordinated production of chemokines and proinflammatory cytokines is probably important in the orchestration of the inflammatory responses ... al. Research article A novel mechanism for the regulation of IFN- γγ inducible protein-10 expression in rheumatoid arthritis Ryosuke Hanaoka 1 , Tsu...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
... stoichiometric binding of protease inhibitors to the catalytic site of the activated forms of the enzymes. In the present work, we have measured by flow cytometry the net proteolytic activity ... 1 Proteolytic activity in synovial fluid of patients with osteoarthritis and inflammatory arthropathiesProteolytic activity in synovial fluid of pat...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "A novel informatics concept for high-throughput shotgun lipidomics based on the molecular fragmentation query language" ppt
... MS/MS Yes Yes Yes Yes Database of lipid masses Yes Yes Yes Yes Yes Yes Database of spectra Yes Database expandability Yes Yes Yes Yes Yes Isotopic correction Yes Yes Yes Yes Cross-platform Yes Yes ... 12:R8 http://genomebiology.com/2011/12/1/R8 Page 22 of 25 METH O D Open Access A novel informatics concept for high-throughput shotgun lipidomics based on the molecular f...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo y học: "A novel and safe technique in closed tube thoracostomy" pdf
... particularly during TT procedure; thus, in many clinics, trocar technique is no longer used [4-7]. In this method, application of drain without finger explora- tion can cause pulmonary parenchymal injuries ... this study have shown that modified com- bined technique can be used safely in thoracic surgery clinics because it reduces the incidence rates of complica- tions and TM, is...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "A novel hybrid aspirin-NO-releasing compound inhibits TNFalpha release from LPS-activated human monocytes and macrophages" docx
... purposes) Journal of Inflammation Open Access Research A novel hybrid aspirin-NO-releasing compound inhibits TNFalpha release from LPS-activated human monocytes and macrophages Catriona M Turnbull 1 , Paolo ... the hybrid compounds were also investigated at 10 μM. Drugs inves- tigated were the furoxan-aspirin hybrids (3-cyanofuroxan- 4-yl)methyl 2-acetoxybenzoate (B8...
Ngày tải lên: 11/08/2014, 08:22
Báo cáo y học: "A novel method to identify and characterise peptide mimotopes of heat shock protein 70-associated antigens" pptx
... purposes) Journal of Immune Based Therapies and Vaccines Open Access Original research A novel method to identify and characterise peptide mimotopes of heat shock protein 70-associated antigens Blanca ... developed a novel method to identify synthetic mimic peptides of Hsp70-PCs and to test their ability to activate T-cells. Peptides (referred to...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "A novel envelope mediated post entry restriction of murine leukaemia virus in human cells is Ref1/ TRIM5a independen" potx
... C H Open Access A novel envelope mediated post entry restriction of murine leukaemia virus in human cells is Ref1/ TRIM5a independent Nidia MM Oliveira † , Roochi Trikha † , Áine McKnight * Abstract Background: ... Lv1, however, Lv2 is determined by envelope (Env) in addition to CA. Here we present evidence of a novel Env determined post entry re...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " A novel function for spumaretrovirus integrase: an early requirement for integrase-mediated cleavage of 2 LTR circles" docx
... end 6 5 substrate CAAAATTCCATGACAATTGTGGTGGAATGCCACTAGAAA CAAAAAACGATGAGTATGTAGGTCCATTGCCACTAGAAA CAAAATTCCATGATTATTATGGTTTAATGCCACTAGAAA CAGAGATAGGTTTGAATGTTGTTACAGTTTGGAACAAGA GAAAATCTCTAGCAGTACTGGAAGGGCTAATTCACTCCC CAGCGGGGGTCTTTCATTAATGAAAGACCCCACCTGTAG * * * * * * * * * * * * * * * * - ... (5'-GAA ACT AGG GAA AAC TAG G-3'), lambdaT (5'-ATG CCA CGT AAG CGA AAC T-3') a...
Ngày tải lên: 13/08/2014, 09:21