Báo cáo y học: "An N-terminally truncated envelope protein encoded by a human" ppt
Báo cáo Y học: Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula officinalis pptx
... Covello
1
1
Plant Biotechnology Institute, Saskatoon, SK, Canada;
2
Department of Chemistry, Carleton University, Ottawa, Ontario, Canada
The mechanism by which the fatty acid (1,4)-desaturase of
Calendula ... Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid
(1,4)-desaturase of
Calendula of cinalis
Darwin W. Reed
1
, Christopher K. Savile
2...
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
... J.,
Qiang, B. & Rao, Z. (2001) Crystallization and preliminary X-ray
analysis of a Trx domain of human thioredoxin-like protein. Acta.
Crystallogr. 57, 1712–1714.
32. Otwinowski, Z. & Minor, ... C-terminal region
is rich in acidic amino acids, if it does have some interaction
with the N-terminal domain, the mechanism of regulating
the catalytic activity may be...
Báo cáo Y học: Ruk is ubiquitinated but not degraded by the proteasome ppt
... immunoprecipitates
were analysed by Western Blot using anti -Ruk antibody raised against the last 17 C-terminal amino acids and thereby able to recognize all Ruk
isoforms (Ruk L, EE-tagged Ruk L, EE-tagged Ruk M and ... antibody to check
expression of Ruk isoforms (C).
Ó FEBS 2002 Ruk is ubiquitinated but not degraded by the proteasome (Eur. J. Biochem. 269) 34...
Báo cáo Y học: Secretion of egg envelope protein ZPC after C-terminal proteolytic processing in quail granulosa cells doc
... C-terminal protein sequencer.
Proteolytic processing of proZPC in granulosa cells
In order to investigate the proteolytic processing of proZPC
in the granulosa cells, we raised antiserum against ... 2002 Proteolytic processing of ZPC in quail granulosa (Eur. J. Biochem. 269) 2227
Secretion of egg envelope protein ZPC after C-terminal...
Báo cáo Y học: The porcine trophoblastic interferon-c, secreted by a polarized epithelium, has specific structural and biochemical properties potx
... expressed in antiviral
IU equivalents by a comparison with a calibrated porcine
IFN -a laboratory standard. The amount of IFN-c (mg) was
determined by ELISA. Specic antiviral activity was
expressedinIUặmg
)1
.
Growth ... potential glyco-
sylation sites present on the IFN-c polypeptide core. They
could differ in the rate and site of glycosylation, considering
the 22 500-Da...
Báo cáo y học: "anagement of upper airway edema caused by hereditary angioedema" pptx
... pulmonary
edema. The exact pathomechanism of this phenomenon
is as yet unknown [8-10].
Edema of airway the upper (UAE) in HAE
1. UAE Mortality
Upper airway edema (UAE) may lead to asphyxia by
causing ... management of hereditary angioedema. Allergy Asthma
Proc 2009, 30(3):338-42.
41. Farkas H, Gyeney L, Gidofalvy E, Fust G, Varga L: The efficacy of short-term
danazol...
Báo cáo y học: "An important step towards completing the rheumatoid arthritis cycle" pptx
... intimately involved in the pathophysiology of
rheumatoid arthritis and complete our model (the rheumatoid arthritis
cycle) for the development and chronic nature of this disease.
Rheumatoid arthritis ... synovial proteins like fibrin(ogen).
Editorial
An important step towards completing the rheumatoid arthritis cycle
Walther J van Venrooij and Ger JM Pruijn
Depa...
Báo cáo y học: " Predictors of disease progression in HIV infection: a review" ppt
... Research, Sydney, Australia, University of New South Wales, Sydney, Australia
Email: Simone E Langford* - simone.langford@med.monash.edu.au; Jintanat Ananworanich - jintanat .a@ searchthailand.org;
David ... found in East Africa
and Subtype CRF_01 AE is seen mainly in Thailand. Cau-
casians are predominantly infected by subtype B, seen in
12% of the global HIV infected population...
Báo cáo y học: "An N-terminally truncated envelope protein encoded by a human" ppt
... with mAb 6A2 B2 on human placenta (A) and an acute MS lesion (B). Arrowheads in A point to
syncytiotrophoblast cell layer. Strong staining with 6A2 B2 was seen in a case of fulminant MS in activated ... propose to
designate ERVWE2, has retained coding capacity and can produce ex vivo an N-terminally truncated Env protein,
named N-Trenv. Detection of an antig en by 6A2 B2 in placen...
Báo cáo y học: " Regulation of primate lentiviral RNA dimerization by structural entrapment" ppt
... Central
Page 1 of 16
(page number not for citation purposes)
Retrovirology
Open Access
Research
Regulation of primate lentiviral RNA dimerization by structural
entrapment
Tayyba T Baig, Christy L Strong, ... hours of culture [52], the majority of their
genomic RNAs may have been matured by slow-acting
dimerization site(s), which may explain why most of their
SL1 m...
Báo cáo y học: " Identification of two distinct structural regions in a human porcine endogenous retrovirus receptor, HuPAR2, contributing to function for viral entry" docx
... c-myc tag was
inserted into the pcDNA3.1(+)/Zeo HuPAR2 backbone by
site-directed mutagenesis with the following primer pair:
5'-CCAGCTTTGGGCTGAATGGAACAAAAACTTATTTCT-
GAAGAA GATCTGATGGCAGCACCCACG ... populations were assayed for PERV -A binding and infection by
a FACS-based PERV -A SU IgG binding assay and a PERV pol qPCR-based infection assay. PERV pol copy numbers were normal-
i...
Báo cáo y học: " An immune reaction may be necessary for cancer development" ppt
... Het-
erotransplantation of human cancers into nude mice; a
model system for human cancer chemotherapy. Cancer 1978,
42:2269-2281.
46. Molthoff CFM, Calame JJ, Pinedo HM, Boven E: Human ovarian
cancer ... infection might be seen; thus, it may like-
wise be facilitated to grow, rather than be inhibited, by
whatever weak immune reaction may be produced.
Indeed, it has bee...
Báo cáo y học: " Binary gene induction and protein expression in individual cells" pptx
... observe binary, hybrid and graded protein
expression.
Protein expression histograms of
β
-gal, Luc and GFP
In examining different mode of gene induction, several
reporter genes have been used. To investigate ... of gene expression histograms for binary and graded modes of gene inductionFigure 1
Schematic representation of gene expression histograms for
binary...
Báo cáo y học: " ISS mapped from ICD-9-CM by a novel freeware versus traditional coding: a comparative study" ppsx
... by
a novel freeware versus traditional coding: a comparative study.
Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2010
18:17.
Di Bartolomeo et al. Scandinavian Journal of ... exploit this advantage, a proprietary program that maps ICD-9-CM into AIS codes has
been used for many years. Recently, a program called ICDPIC trauma and developed in the U...
Báo cáo y học: "Creation and disruption of protein features by alternative splicing a novel mechanism to modulate function" docx
... ++++g + + G++ SK eAkq+AA +AL ++
FSVSAELDGVV CPAGTANSKTEAKQQAALSALCYI
AeaALrkL
A+ +A+ + L
AARAWENL
pksaLqelaqkrklplpeYelvkeeGptPahaprFtvevkvggktyvrktfgeGsGsSKKeAkqaAAeaALrkL
++s+L e +a l + l +e++p P+ ... of AG-GT splice sites. All splice forms were
General mechanisms to alter linear protein features by alternative splicingFigure 3
General mechanisms to alter linear protein f...
Từ khóa: