... Covello 1 1 Plant Biotechnology Institute, Saskatoon, SK, Canada; 2 Department of Chemistry, Carleton University, Ottawa, Ontario, Canada The mechanism by which the fatty acid (1,4)-desaturase of Calendula ... Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula of cinalis Darwin W. Reed 1 , Christopher K. Savile 2...
Ngày tải lên: 08/03/2014, 09:20
... J., Qiang, B. & Rao, Z. (2001) Crystallization and preliminary X-ray analysis of a Trx domain of human thioredoxin-like protein. Acta. Crystallogr. 57, 1712–1714. 32. Otwinowski, Z. & Minor, ... C-terminal region is rich in acidic amino acids, if it does have some interaction with the N-terminal domain, the mechanism of regulating the catalytic activity may be...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo Y học: Ruk is ubiquitinated but not degraded by the proteasome ppt
... immunoprecipitates were analysed by Western Blot using anti -Ruk antibody raised against the last 17 C-terminal amino acids and thereby able to recognize all Ruk isoforms (Ruk L, EE-tagged Ruk L, EE-tagged Ruk M and ... antibody to check expression of Ruk isoforms (C). Ó FEBS 2002 Ruk is ubiquitinated but not degraded by the proteasome (Eur. J. Biochem. 269) 34...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo Y học: Secretion of egg envelope protein ZPC after C-terminal proteolytic processing in quail granulosa cells doc
... C-terminal protein sequencer. Proteolytic processing of proZPC in granulosa cells In order to investigate the proteolytic processing of proZPC in the granulosa cells, we raised antiserum against ... 2002 Proteolytic processing of ZPC in quail granulosa (Eur. J. Biochem. 269) 2227 Secretion of egg envelope protein ZPC after C-terminal...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo Y học: The porcine trophoblastic interferon-c, secreted by a polarized epithelium, has specific structural and biochemical properties potx
... expressed in antiviral IU equivalents by a comparison with a calibrated porcine IFN -a laboratory standard. The amount of IFN-c (mg) was determined by ELISA. Specic antiviral activity was expressedinIUặmg )1 . Growth ... potential glyco- sylation sites present on the IFN-c polypeptide core. They could differ in the rate and site of glycosylation, considering the 22 500-Da...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo y học: "anagement of upper airway edema caused by hereditary angioedema" pptx
... pulmonary edema. The exact pathomechanism of this phenomenon is as yet unknown [8-10]. Edema of airway the upper (UAE) in HAE 1. UAE Mortality Upper airway edema (UAE) may lead to asphyxia by causing ... management of hereditary angioedema. Allergy Asthma Proc 2009, 30(3):338-42. 41. Farkas H, Gyeney L, Gidofalvy E, Fust G, Varga L: The efficacy of short-term danazol...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "An important step towards completing the rheumatoid arthritis cycle" pptx
... intimately involved in the pathophysiology of rheumatoid arthritis and complete our model (the rheumatoid arthritis cycle) for the development and chronic nature of this disease. Rheumatoid arthritis ... synovial proteins like fibrin(ogen). Editorial An important step towards completing the rheumatoid arthritis cycle Walther J van Venrooij and Ger JM Pruijn Depa...
Ngày tải lên: 09/08/2014, 13:21
Báo cáo y học: " Predictors of disease progression in HIV infection: a review" ppt
... Research, Sydney, Australia, University of New South Wales, Sydney, Australia Email: Simone E Langford* - simone.langford@med.monash.edu.au; Jintanat Ananworanich - jintanat .a@ searchthailand.org; David ... found in East Africa and Subtype CRF_01 AE is seen mainly in Thailand. Cau- casians are predominantly infected by subtype B, seen in 12% of the global HIV infected population...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "An N-terminally truncated envelope protein encoded by a human" ppt
... with mAb 6A2 B2 on human placenta (A) and an acute MS lesion (B). Arrowheads in A point to syncytiotrophoblast cell layer. Strong staining with 6A2 B2 was seen in a case of fulminant MS in activated ... propose to designate ERVWE2, has retained coding capacity and can produce ex vivo an N-terminally truncated Env protein, named N-Trenv. Detection of an antig en by 6A2 B2 in placen...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Regulation of primate lentiviral RNA dimerization by structural entrapment" ppt
... Central Page 1 of 16 (page number not for citation purposes) Retrovirology Open Access Research Regulation of primate lentiviral RNA dimerization by structural entrapment Tayyba T Baig, Christy L Strong, ... hours of culture [52], the majority of their genomic RNAs may have been matured by slow-acting dimerization site(s), which may explain why most of their SL1 m...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: " Identification of two distinct structural regions in a human porcine endogenous retrovirus receptor, HuPAR2, contributing to function for viral entry" docx
... c-myc tag was inserted into the pcDNA3.1(+)/Zeo HuPAR2 backbone by site-directed mutagenesis with the following primer pair: 5'-CCAGCTTTGGGCTGAATGGAACAAAAACTTATTTCT- GAAGAA GATCTGATGGCAGCACCCACG ... populations were assayed for PERV -A binding and infection by a FACS-based PERV -A SU IgG binding assay and a PERV pol qPCR-based infection assay. PERV pol copy numbers were normal- i...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: " An immune reaction may be necessary for cancer development" ppt
... Het- erotransplantation of human cancers into nude mice; a model system for human cancer chemotherapy. Cancer 1978, 42:2269-2281. 46. Molthoff CFM, Calame JJ, Pinedo HM, Boven E: Human ovarian cancer ... infection might be seen; thus, it may like- wise be facilitated to grow, rather than be inhibited, by whatever weak immune reaction may be produced. Indeed, it has bee...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: " Binary gene induction and protein expression in individual cells" pptx
... observe binary, hybrid and graded protein expression. Protein expression histograms of β -gal, Luc and GFP In examining different mode of gene induction, several reporter genes have been used. To investigate ... of gene expression histograms for binary and graded modes of gene inductionFigure 1 Schematic representation of gene expression histograms for binary...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: " ISS mapped from ICD-9-CM by a novel freeware versus traditional coding: a comparative study" ppsx
... by a novel freeware versus traditional coding: a comparative study. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2010 18:17. Di Bartolomeo et al. Scandinavian Journal of ... exploit this advantage, a proprietary program that maps ICD-9-CM into AIS codes has been used for many years. Recently, a program called ICDPIC trauma and developed in the U...
Ngày tải lên: 13/08/2014, 23:21
Báo cáo y học: "Creation and disruption of protein features by alternative splicing a novel mechanism to modulate function" docx
... ++++g + + G++ SK eAkq+AA +AL ++ FSVSAELDGVV CPAGTANSKTEAKQQAALSALCYI AeaALrkL A+ +A+ + L AARAWENL pksaLqelaqkrklplpeYelvkeeGptPahaprFtvevkvggktyvrktfgeGsGsSKKeAkqaAAeaALrkL ++s+L e +a l + l +e++p P+ ... of AG-GT splice sites. All splice forms were General mechanisms to alter linear protein features by alternative splicingFigure 3 General mechanisms to alter linear protein f...
Ngày tải lên: 14/08/2014, 14:21