Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
Báo cáo y học: " Use of the novel hemostatic textile Stasilon® to arrest refractory retroperitoneal hemorrhage: a case report" pps
... composed of fiberglass and bamboo yarns incorporated into a proprietary weave. It hasbeen cleared by the United States Food and Drug Administration for external and internal use and has been granted ... of an array of potentially hemostatic textile materials and it has been cleared for bothexternal and internal use by the United States Food and Drug Administration for the arrest of hemorrhage. ... quadrant. Electrocautery and suture ligationwere ineffective and the abdomen was repacked withcotton laparotomy pads and the abdomen left open.Mesenteric ang iography was performed after failure...
- 5
- 389
- 0
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt
... R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG and R5-TM-R, AATTCCTATTCTATATATACTATGGTCCACACGACTATT-GCTATGATTAGTGCTA CTATCAATGCTCCTACTC-CTAATTTATAATCTAAATTTAACATCTC. The cytoplasmicdomains were ... NL-TM-R,AATTCCTATTCTATGATTACTATGGACCACACAGCTATTGCTATTATTATTGCTACTACTAATGCTACTATTGCTAC-TATTATAGGTTGCATCTC; for the R5 vpu TM region, R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG ... GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu-R5-F, GGATCCATGTTAAATTTA-GATTATAAATTAGGAGTA GG and Vpu-R5-R, GAAT-TCATTACAAATCATTAACATCCAAAAGCC. The amplifiedfragments designated as NL vpu and...
- 11
- 436
- 0
Báo cáo y học: " Production of infectious human immunodeficiency virus type 1 does not require depletion of APOBEC3G from virus-producing cells" pdf
... (A & D) and a Vif monoclonal antibody (B & E) as in figure 2 and analyzed on a confocal microscope. Panels C & F are overlays of panels A & B and D & E, respectively. Arrow ... E) anti-Vif MAb #319 + anti-Myc polyclonal antibody; (C & F) anti-Vif MAb #319 + anti-APO3G polyclonal antibody. Vif was visualized using Cy2-conjugated secondary antibodies (green) and APOBEC3G ... was used for all immunoblotanalyses and some of the immunohistochemical analysesas indicated in the text and was obtained from MichaelMalim through the NIH AIDS Research and ReferenceReagent...
- 12
- 279
- 0
Báo cáo y học: " Identification of restriction endonuclease with potential ability to cleave the HSV-2 genome: inherent potential for biosynthetic versus live recombinant microbicides" pdf
... needed. For instance,the P23 promoter from Lactococcus lactis created by PCRamplification with the primers 5'-GTGGAGCTC-CCCGAAAAGCCCTGACAACCC-3' and 5'-GGAAACACGCTAGCACTAACTTCATT-3', ... Savvy (C31G) [28]; and plant derivative like Pra-neem polyherbal suppository and gossypol may serve thepurpose. Note that meta-analysis of randomized control-led trials including more than ... recombinant microbicidesMisaki Wayengera*1,2,3,4, Henry Kajumbula1,3 and Wilson Byarugaba1,4Address: 1Restrizymes Biotherapeutics Uganda Limited, Kampala, Uganda, 2Restrizymes Corporation-...
- 12
- 376
- 0
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... this article as: Lewis et al.: Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence ... RESEA R C H Open Access Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence ... Act and The Guide for the Care and Use of Laboratory Animals, as well as according to animal carestandards deemed acceptable b y the Association for theAssessment and Accredi tation of Laboratory...
- 19
- 317
- 0
Báo cáo y học: " Response of pulmonary artery intimal sarcoma to surgery, radiotherapy and chemotherapy: a case report" docx
... survival of patients and therapies such as chemother-apy and radiotherapy may also contribute to the manage-ment of this disease, and where appropriate should berecommended. In addition, systematic ... still not clearly defined. The sameis true for radiation therapy and postoperative anticoagu-lation therapy [8]. The prognosis of PA intimal sarcoma ispoor, and survival is usually 12 to 18 months ... theincidence of aortic intimal sarcoma. The mean age of patients diagnosed with PA intimal sarcoma is 48 years,while the mean age of patients at diagnosis of aortic inti-mal sarcoma is 62 years [3,4].PA...
- 3
- 282
- 0
Báo cáo y học: "Response of the mouse lung transcriptome to welding fume: effects of stainless and mild steel fumes on lung gene expression in A/J and C57BL/6J mice" pot
... theIPA analysis and drafted the manuscript. MLK and SL were responsible for thestatistical design, data management, statistical analysis and clustering analysis for these studies. JMA and PCZE ... light/12 hourdark) at a standard temperature (22-24°C) and 30-70%relative humidity. Animals were acclimated to the animal facility for a minimum of 1 week and allowed access to a conventional diet ... Pathology and Physiology Research Branch, National Institute for Occupational Safety and Health, Morgantown, 26505, USA and 2Health Effects Laboratory Division, Biostatistics and Epidemiology Branch,...
- 18
- 382
- 0
Báo cáo y học: "Risk of acute myocardial infarction with nonselective non-steroidal anti-inflammatory drugs: a meta-analysis" ppsx
... anti-inflammatoryagents, non steroidal anti-inflammatory) and AMI (for instance,myocardial infarction, myocardial ischemia, cardiac ischemia,death) were combined to capture all potentially ... non-steroidal anti-inflammatory drugs: a meta-analysisGurkirpal Singh1,2, Olivia Wu3, Peter Langhorne4 and Rajan Madhok51Division of Gastroenterology and Hepatology, Stanford University School ... anti-inflammatory drugs(NSAID) and aspirin for preventing colorectal adenomas and carcinomas. Cochrane Database Syst Rev 2004, 2:CD004079.8. Cryer B, Feldman M: Cyclooxygenase-1 and cyclooxygenase-2selectivity...
- 9
- 279
- 0
Báo cáo y học: " Impact of concomitant DMARD therapy on adherence to treatment with etanercept and infliximab in rheumatoid arthritis. Results from a six-year observational study in southern Sweden" docx
... co-morbidities at treatment initiation for the infliximab and the etanercept groups. Patients initiatingtherapy were checked for an up -to- 10-year prior history of car-diovascular diseases, any malignancies, ... infliximab, etanercept, as well as adalimumab werewidely available (Figure 1). The number of biologic-naïvepatients starting adalimumab was too limited to allow mean-ingful analysis, and patients ... that patients who tolerate MTX well also are likely to tol-erate TNF-blocking agents. Thus, tolerance to MTX therapymay be used as a surrogate measure for potential high tolera-bility of anti-TNF...
- 10
- 502
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenevaluation of a combined treatment with iron sucrose and erythropoietin alpha predictors of response efficacy and safetyfuture application of integrative therapies for sepsis bench and experimental animal modelsbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ