Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt

... evaluate iron deficiency. Most of patients with iron deficiency in, whom gastrointestinal or systemic signs or symptoms are absent have an underlying ga- strointestinal lesion [24]. Idiopathic iron- deficiency ... â Ivyspring International Publisher. All rights reserved. Research Paper Identification of clinical and simple laboratory variables predicting r...

Ngày tải lên: 25/10/2012, 11:18

... soluble cellular < /b> proteins < /b> interacting < /b> with < /b> a bait of < /b> interest [5], it can not be applied in the isolation of < /b> those interacting < /b> with < /b> transmembrane bait proteins < /b> such as HBsAg. A yeast split-ubiquitin ... its interacting < /b> prey [5]. However, such a screening system is not suitable for the analysis of < /b> interacti...

Ngày tải lên: 02/11/2012, 11:08

... 269) Ó FEBS 2002 Characterization of an omega-class glutathione S -transferase from Schistosoma mansoni with glutaredoxin-like dehydroascorbate reductase and thiol transferase activities Javier ... transferase enzymatic activities. Keywords: glutathione S -transferase; dehydroascorbate reductase; thiol transferase; Schistosoma. Glutathione S...

Ngày tải lên: 21/02/2014, 01:21

... sorted cellsReanalysis of triple positive sorted cells. (a) Forward and side scatter characteristics of sorted osteoarthritic cartilage cells. (b-d) CD9-fluorescein isothiocyanate (FITC)/CD166-phycoerythrin ... split by trypsin treatment (0.05% trypsin, 0.02% EDTA; Biochrom) at 75% confluence. Flow cytometry analysis of cells Either isolated cells from OC were directly...

Ngày tải lên: 09/08/2014, 01:23

... of the anti -SmD3 peptide (SMP) assayAssay performance characteristics of the anti -SmD3 peptide (SMP) assay. (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating ... (Rheumaklinik Aachen, Aachen, Germany), Prof. Dr MJ Fritzler (University of Calgary, Calgary, Canada) and by Labor Limbach (Heidelberg, Germany). To assess further the assay specificity...

Ngày tải lên: 09/08/2014, 06:22

... participated in analysis of data. CA performed the statistical analysis and the clinical associa- tions. AS participated in the analysis and interpretation of data and in the revision of the manuscript. ... article Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lup...

Ngày tải lên: 09/08/2014, 06:23

... pathophysiology of endothelial cells, and antibody to endothelial cell antigen (AECA) has been reported. Reports on the prevalence of AECA have varied largely and alpha-eno- lase was reported as ... Reiter's syndrome, inflammatory bowel diseases etc. On the other hand, further analysis of the association of anti -kinectin antibody with different manifesta- tions or disease &...

Ngày tải lên: 09/08/2014, 07:20

... determined by using a cytokine protein array (TranSignal Mouse Cytokine Antibody Array 1.0; Panomics, Inc., Fremont, CA, USA) according to the manufacturer's instructions. Enzyme-linked ... article TWEAK/Fn14 interaction regulates RANTES production, BMP-2-induced differentiation, and RANKL expression in mouse osteoblastic MC3T3-E1 cells Takashi Ando 1 *, Jiro...

Ngày tải lên: 09/08/2014, 08:22

... modification at the key MHC anchor position. The latter quality may add to improved safety of APL therapy. Ideally, the properties of an APL for immunotherapy of RA would blend: affinity for MHC class ... substitutions may function as partial TCR agonists on the one hand and prevent unwanted immune reactivity on the other [32,33]. This approach may thus provi...

Ngày tải lên: 09/08/2014, 10:20

... Access Identification of < /b> an < /b> effective < /b> siRNA < /b> target < /b> site < /b> and < /b> functional < /b> regulatory < /b> elements, < /b> within < /b> the < /b> hepatitis < /b> B virus posttranscriptional regulatory < /b> element Nattanan Panjaworayan 1 , Sunchai Payungporn 2 , Yong ... detected by real-time PCR assay and < /b> used to prepare the < /b> sta...

Ngày tải lên: 12/08/2014, 01:21

... for therapeutic intervention in pulmonary hypertension. Pharmacol Ther 2001, 92:1-20. 3. Rabinovitch M: Pulmonary vascular remodeling in hypoxic pulmonary hypertension. In Hypoxic Pulmonary Vasoconstriction ... involvement of bone marrow cells in pulmonary hypertension and vascular remodeling. Although Young et al. reported that inhibition of CXCR4 activit...

Ngày tải lên: 12/08/2014, 13:22

... placenta (right) and haematoxylin and eosin staining of a day 12 placenta section (left) with the 3 main layers of the placenta indicatedFigure 6 Structure and in situ hybridization for syncytin-Ory1 ... syncytin-Ory1 expression of day 12 rabbit placenta: (A) Schematic repre- sentation of a rabbit placenta (right) and haematoxylin and eosin staining of a da...

Ngày tải lên: 12/08/2014, 23:22

... c-myc tag was inserted into the pcDNA3.1(+)/Zeo HuPAR2 backbone by site-directed mutagenesis with the following primer pair: 5'-CCAGCTTTGGGCTGAATGGAACAAAAACTTATTTCT- GAAGAA GATCTGATGGCAGCACCCACG ... populations were assayed for PERV -A binding and infection by a FACS-based PERV -A SU IgG binding assay and a PERV pol qPCR-based infection assay. PERV pol copy numbers were normal- i...

Ngày tải lên: 13/08/2014, 05:21

... cord injury and other inflammatory or destructive conditions of the CNS[24,25]. We investigated the cross packaging ability of the Gag-Pol components of HIV-1, HIV-2 and SIV and found a unique non -reciprocal ... 60% of glial cell expressing GFP with 20 ng of input vector and approximately 58% with 10 ng of vector. In summary, the gene transfer effi...

Ngày tải lên: 13/08/2014, 09:21

... embryo by means of the immunosuppressive domain [52]. Two seemingly intact env genes not detected in the recent survey of intact human envelope genes [41] are equally interesting in terms of possible ... [2]. Finally, screening the human genome in silico does not guarantee detection of polymorphic HERV loci in which the empty pre-integra- tion site is still segrega...

Ngày tải lên: 13/08/2014, 13:20