Báo cáo y học: " Comparative biochemical analysis of HIV-1 subtype B and C integrase enzymes" pot

... for both subtype < /b> enzymes (Table 1), consistent with previously reported data for subtype < /b> B integrase [18]. The strand transfer activity of < /b> subtype < /b> B and C recom- binant proteins was inhibited by ... Nega- tive control lane without integrase enzyme. Top panel, subtype < /b> B integrase; bottom panel, subtype < /b> C integrase. Table 1: IC 50...

Ngày tải lên: 12/08/2014, 23:22

... subtype < /b> B and C RT enzymes. Results Purification of < /b> recombinant HIV-1 < /b> RTs from subtype < /b> B and subtype < /b> C The subtype < /b> C HIV-1 < /b> RT sequence used in this study differs from consensus subtype < /b> B RT by ... 3 ’- GACGTCTTATAACGATCGCCCTTAAGCCGCGC - 5 ’ -1 -10 -20 Kim40R 5’-AAGCUUGGCUGCAGAAUAUUGCUAGCGGGAAUUCGGCGCG-3’ Kim32D 3 ’- GACGT...

Ngày tải lên: 13/08/2014, 01:20

... infect Campylobacter [17], Eschericia coli [18], and also many Carrias et al. Virology Journal 2011, 8:6 http://www.virologyj.com/content/8/1/6 Page 3 of < /b> 12 Comparative < /b> genomic analysis < /b> of < /b> bacteriophages specific ... 12 RESEARC H Open Access Comparative < /b> genomic analysis < /b> of < /b> bacteriophages specific to the channel catfish pathogen Edwardsiella...

Ngày tải lên: 11/08/2014, 21:21

... ACGTTCAAGACCAGCGAGTT CCTCCAGCATGGTGATACCT Pdgfrb CACCTTCTCCAGTGTGCTGA GGAGTCCATAGGGAGGAAGC Tek AAGCATGCCCATCTGGTTAC GCCTGCCTTCTTTCTCACAC Fbx15 GGCCTTGAATGGAGAACTGA TCAAACCACCCTAGGTCTGC Dnmt3l CCTGGTGAAGAACTGCCTTC ... GTCATGGCCATGGTCGAGTA CTCCTCGGCGATCTTGCTGAA Lyve-1 AGGAGCCCTCTCCTTACTGC ACCTGGAAGCCTGTCTCTGA vWF GCCAAAGATCTGGAACAGTGT GATGGAGAGGTTACACATCTC F2 CAGCTATGAGGAGGCCTTTG TCACACCCAGATCC...

Ngày tải lên: 14/08/2014, 08:20

... Tc B1 4 Tc B1 5 Dm CG12789 Ag BQ4 Tc B1 0 Tc B1 1 Tc B1 2 Tc B1 3 Dm CG7000 Ag B1 Tc B1 Tc B3 0.1 Dm peste Tc B4 Tc B6 Dm CG10345 Am B5 Am B1 Tc B5 Ag B5 Am B3 Tc B8 Dm CG3829 Ag B8 Tc ... CG2727 Ag B9 Dm CG7227 Tc B2 Am B2 Dm CG1887 Ag B3 Dm CG4280 /croq uemort Ag BQ2 Tc B7 Tc B1 6 Tc B1 4 Tc B1 5 Dm CG12789 Ag BQ4 Tc B1 0 Tc B1 1 Tc B...

Ngày tải lên: 14/08/2014, 08:20

... Ashbya gossy Kluyveromyces Saccharomyce Candida glab Debaryomyces han Yarrowia lipolytica (30) Schizosaccharomyces pom Coprinopsis cinerea (1621) Phanerochaete chrysosporium Cryptococcus neoforman Ustilago ... fungal clade (Euascomycota, Hemiascomycota, or Basidiomycota), or specific to the species or clade. 0% 25% 50% 75% 100% A+P Plant Animal Fungi Clade/Species-specific S. cerevisiae...

Ngày tải lên: 14/08/2014, 08:20

... AAC 62,939 CUU → CGU 25,168 ACC → ACC 60,208 ACC → ACC 50,735 CAA → CAG 24,507 CCA → CCA 47,603 CCA → CCA 39,196 AAA → AAG 23,593 ACA → ACA 47,359 CAC → CAC 39,032 UUC → AAA 22,86 CAC → CAC 47,175 ... using the complete ORFeome sequences of < /b> the eukary- otes Saccharomyces cerevisiae, Candida albicans and Schizosaccharomyces pombe and the bacterium Escherichia coli. The methodology d...

Ngày tải lên: 14/08/2014, 14:21

... released to yield pyruvate by the decarbox- ylating NADP-ME. The released CO 2 concentrates around the secondary carboxylase, Rubisco, and is reassimilated by it through the Calvin cycle. Pyruvate ... cell CO2 HCO3 PEPC PPCK OAA (C4 ) MDH Malate (C4 ) ME CO2 Pyruvate (C4 ) PPDK PEP (C3 ) Calvin cycle TP chloroplast chloroplast CytosolCytosol RP http://genomebiology.com/2009/10/6/R68 G...

Ngày tải lên: 14/08/2014, 21:20

... al. Effect of < /b> cardiac resyn- chronization therapy on longitudinal and circumferential left ventricular mechanics by velocity vector imaging: description and initial clinical application of < /b> a novel ... the Clinical Ap- plication of < /b> Echocardiography: summary article. A report of < /b> the American College of < /b> Cardiology/American Heart Association Task Force on...

Ngày tải lên: 25/10/2012, 11:15

... disease activity. Conclusion Biomarker analysis < /b> of < /b> diseased tissue in proof -of-< /b> concept clinical trials can potentially be used to prioritize therapeu- tic targets and can correlate with clinical efficacy. ... McGilveray IJ, Skelly JP, Yacobi A, Layloff T, Viswanathan CT, Cook CE, McDowall RD, Pittman KA, Spector S: Analytical methods validation: bioavailability, bio- e...

Ngày tải lên: 09/08/2014, 01:23