... Veterinary Etiological Biology, Key Laboratory of Animal Virology of the Ministry of Agriculture, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, No. 1 Xujiaping, Yanchangbao, ... TTGAAAGGGGGCGCTAGGGTCT 1-22 Pan/S- AAAACTTAGGGGGGGGGGGGGGGGGGGGTGAAAGG 36 2 -37 6[b] Pan/I+ CCTTTCACCCCCCCCCCCCCCCCCCCCTAAGTTTT 36 2 -37 6[b] L3 GTTCTGGTACTGCTGCATGTAG 17...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: " Genetic characterization of the complete genome of a highly divergent simian T-lymphotropic virus (STLV) type 3 from a wild Cercopithecus mona monkey" ppt
... purposes) Retrovirology Open Access Research Genetic characterization of the complete genome of a highly divergent simian T-lymphotropic virus (STLV) type 3 from a wild Cercopithecus mona monkey David M Sintasath 1 , ... 8699GF21 AGA TGT CCT CCA GCA ATG CCA AAG PGPOLR2 GRY RGG IGT ICC TTT IGA GAC CCA 992 E pol-env Outer 7867GPF2 TCC ACA GAA AAA AC...
Ngày tải lên: 12/08/2014, 23:22
... Electron spinresonancestudyoftheroleofnitricoxideandcatalaseinthe activation of guanylate cyclase by sodium azide and hydro- xylamine. Modulation of enzyme responses by heme proteins and their nitrosyl derivatives. J. Biol. Chem. 254, 82 13 8222. 12. ... spectroscopy of the hydrogen peroxide adduct shows the loss of both high-spin and low-spin ferric signals and the appearance...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo y học: " Genetic characterization of wild-type measles viruses isolated in China, 2006-2007" doc
... Lijuan Nan 13 , Li Li 2 , Xiaofeng Liang 2 , David Alexander Featherstone 14 , PaulARota 15 , William J Bellini 15 and Wenbo Xu* 1 Abstract Molecular characterization of wild -type measles viruses ... of the serological testing for case confirmation. The National Measles Lab- oratory (NML) has played an important role in measles control and measles virus surveillance and wa...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Genetic polymorphisms in the nucleotide excision repair pathway and lung cancer risk: A meta-analysis"
... analysis offers the advantage of not assuming that any of the genotyped polymorphisms is functional; rather, it allows for the possibility of an ungenotyped functional variant to be in linkage ... RPA and XPA preferentially bind damaged DNA, and because RPA and XPA di- rectly interact in the absence of DNA, the RPA-XPA complex has been implicated as a key component in...
Ngày tải lên: 31/10/2012, 14:59
Báo cáo khóa học: Genetic approaches to the cellular functions of polyamines in mammals potx
... showing that the inflammatory process could be totally prevented, as judged by histopathology and plasma a- amylase activity, by a prior administration of a- methylspermidine, a metabolically stable spermidine ... In the total absence of spermine, the targeted cells grew at a rate that was practically similar to that of the parental cells and displayed no morphological ab...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo sinh học: " Genetic lesions within the 3a gene of SARS-CoV" ppt
... 2 Detection of myc-3amut1 in transfected Vero E6 cells by FACS and Western blot analysis. (A) FACS analysis of live cells transfected with myc- 3a, myc-3amut1 and myc-GST. Cells were initially probed ... Wang HY, Tsai CY, Kao CL, Yang JY, Liu HW, Su IJ, Tsai SF, Chen DS, Chen PJ: Characterization of severe acute respira- tory syndrome coronavirus genomes in Taiwan: molecular epidemio...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Genetic lesions within the 3a gene of SARS-CoV" pdf
... smaller 3a gene products. We have shown that at least one of these truncated forms of 3a, named as 3amut1, can be detected in the lysate of infected cells [6]. It has been shown that the 3a is ... Vero E6 cells by FACS and Western blot analysis. (A) FACS analysis of live cells transfected with myc- 3a, myc-3amut1 and myc-GST. Cells were initially probed with anti-myc monoclonal...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo y học: "Does eGFR improve the diagnostic capability of S-Creatinine concentration results? A retrospective population based study" ppsx
... and an age compensating factor of about 0,45 (0,54 at 20 years and 0,42 at 80 years) and a magnifying constant factor (174-186) will drastically change the diagnostic power of the measurand. ... kidney disease. J Am Soc Nephrol 20 03; 14:25 73 80. 19. Khatami Z, Handley G, Narayanan K, Weaver JU. Applicability of estimated glomerular filtration rate in stratifying chronic k...
Ngày tải lên: 08/08/2014, 16:23
Báo cáo y học: "Physical anhedonia in the acute phase of schizophrenia" doc
... Fifty were male (62%) and 31 female (38 %). Their mean age was 30 .95 (± 8.91) years, (age range 17 to 50 years). They had a mean of 12.6 (± 2.7) years of education, a mean duration of illness of ... that in the acute phase of schizophrenia, physical anhedonia may be a compo- nent of patient's psychopathology. Further studies to elu- cidate the nature of physic...
Ngày tải lên: 08/08/2014, 21:20