Báo cáo y học: " Unintended spread of a biosafety level 2 recombinant retrovirus" ppsx

Báo cáo y học: " Unintended spread of a biosafety level 2 recombinant retrovirus" ppsx

Báo cáo y học: " Unintended spread of a biosafety level 2 recombinant retrovirus" ppsx

... (CTGCCCT- GTATCATCTGAACC) and T3R3 4a (CTCCCCTGAC ATT CAACGC) amplifying the gag gene of the viral genome whereas for the murine hybrid retrovirus primers T3R27s2 (CAGGGAGAACATGGTAATAGGA) and T3R2 7a2 (ACGACCTCTCCAAAGTATCCA) ... Interna- tional Journal of Cancer 1974, 13 :24 6 -25 3. 14. Popovic M, Kalyanaraman VS, Reitz MS, Sarngadharan MG: Identifi- cation of the Rpmi- 822 6 Retrovi...

Ngày tải lên: 12/08/2014, 23:22

6 350 0
Báo cáo y học: " Direct spread of thyroid follicular carcinoma to the parotid gland and the internal jugular vein: a case report" pot

Báo cáo y học: " Direct spread of thyroid follicular carcinoma to the parotid gland and the internal jugular vein: a case report" pot

... Doncaster, UK, 2 Department of Histopathology, Doncaster Royal Infirmary, Doncaster, UK and 3 Department of Radiology, Doncaster Royal Infirmary, Doncaster, UK Email: Ahmed Alzaraa* - ahmedwahabf@gmail.com; ... internal jugular vein: a case report Ahmed Alzaraa* 1 , Jason Stone 2 , Glyn Williams 3 , Irfan Ahmed 1 and Mohammed Quraishi 1 Address: 1 Department of Otolaryngology...

Ngày tải lên: 11/08/2014, 21:22

3 298 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

... Nosocomial Pathogens in Turkey Adalet Altunsoy 1 , Cenk Aypak 2  , Alpay Azap 1 , Önder Ergönül 3 , İsmail Balık 1 1. Department of Clinical Microbiology and Infectious Disease, Ankara University, ... leading nosocomial pathogens. Materials and Methods Hospital setting and antibiotic policy: NARP was initiated in Turkey in February 20 03 by a central regulation of Ministry...

Ngày tải lên: 25/10/2012, 11:00

6 692 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

... moiety of A2 0 1A and puromycin by S. capreolus and S. alboniger, respectively. Considering that most, if not all, of the genes between ard1 and ard2 are part of the ata cluster, ata 12 and ataPKS1 should ... play a role in A2 0 1A biosynthesis. In contrast, upstream of ard1 there are six contiguous coding sequences with identical orientation (Figs2and 3A) .Ofthese,five(ataP3, a...

Ngày tải lên: 21/02/2014, 01:21

9 728 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... thermotolerance Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae Department of Biology, Dalhousie University, Halifax, Nova Scotia, Canada Oviparously developing embryos of the brine shrimp, Artemia franciscana, ... 400 lL of p26 purified from Artemia cysts [57], and molecular mass markers o f 29 kDa (carbonic anhydrase), 66 k Da (bovine serum albumin), 150 kDa (alcohol dehydr...

Ngày tải lên: 22/02/2014, 04:20

10 495 0
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

... given in parentheses): Arabidopsis thaliana 4CL1 (U18675), A. thaliana 4CL2 (AF106086), A. thaliana 4CL3 (AF106088), G. max 4CL1 (AF27 926 7), G. max 4CL2 (AF0 022 59), G. max 4CL3 (AF0 022 58), G. max 4CL4 (X69955), ... was substantiated by the observation that isoenzymes of 4CL in soybean (Glycine max), petunia ( Petunia hybrida), pea (Pisum sativum), oat ( Avena sativa), and poplar (Po...

Ngày tải lên: 22/02/2014, 04:20

12 448 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

... study CE1514 CE 122 4 Tn10 secYts24 This study CE1515 CE 122 4 secB::Tn5 This study FF283 F – , lacDx74 araD139 (araABOIC-leu) D7679 galU galK rpsL ffs::kan/F¢ lac-pro, lacI q Ptac::ffs [ 52] Plasmids pJP29 ... a known substrate of the SRP pathway, FtsQ was used as a model. This class II membrane protein, with a short N-terminal cytoplasmic tail [39], was synthesized as a slightly lo...

Ngày tải lên: 08/03/2014, 09:20

8 547 0
Báo cáo Y học: Defective translocation of a signal sequence mutant in a prlA4 suppressor strain of Escherichia coli doc

Báo cáo Y học: Defective translocation of a signal sequence mutant in a prlA4 suppressor strain of Escherichia coli doc

... prlA mutations cause a general relaxation of the export apparatus [21 ,24 ] rather than a specific change that results in bypassing a proofreading mechanism of the Sec machinery [25 ]. The energy ... polyclonal anti- bodies directed against leader peptidase and analysis by SDS/PAGE and autoradiography. Proteinase K-accessibility experiments Cells of prlA4 mutant strain NT1004, carr...

Ngày tải lên: 08/03/2014, 09:20

9 493 0
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf

Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf

... reactivity of a- hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite Hiroshi Sakamoto 1 , Yoshiaki Omata 1 , Shunsuke Hayashi 1 , Saori Harada 1 , Graham Palmer 2 and ... can contain a substantial amount of free a- hydroxyhaem and this can lead to an incorrect interpret- ation of the nature of the enzyme-assisted conversion of a- hydroxyhaem...

Ngày tải lên: 23/03/2014, 21:20

9 502 0
Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

... recently, the enzymatic deglucosylation of dolichantoside by a crude enzyme preparation from Strychnos mellodora resulted in the formation of a quaternary alkaloid, Nb-methyl -21 -hydroxy-mayumbine, as ... reverse) and GSP5b (5¢-GT GCATACAACGAAGGCAATCGAGGTCC-3¢, reverse) using Marathon TM cDNA Amplification Kit and Advant- ageÒ cDNA polymerase from Clontech (Heidelberg, Germany) accord...

Ngày tải lên: 24/03/2014, 03:21

10 650 0
w