... by unleashing NMDA and AMPA excitotoxic injury. Thus a mecha- nism by which abnormal energy metabolism may have an influence on clinical ALS is through depletion of Vgf neuroprotection against ... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamin...
Ngày tải lên: 03/11/2012, 10:52
... 2011 The Authors Journal compilation ª 2011 FEBS Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus Benjamin Marie 1,2 , Isabelle Zanella-Cle ´ on 3 , Marion ... CaCO 3 precipitation. First, the effect of the nacre matrix started to occur above 1 lg of the ASM and the delay of the reaction was dose- dependent. At...
Ngày tải lên: 22/03/2014, 16:20
báo cáo hóa học:" Research Article A Systematic Development Methodology for Mixed-Mode Behavioral Models of In-Vehicle " docx
... device mixed-mode behavioral model of a CAN bus transceiver and a generic mixed-mode behavioral model of a Flexray physical layer transceiver. The paper presents how the pro- posed methodology was applied ... behavior of mixed-mode- embedded systems are essential for achieving reliable simulation results. This paper presents a systematic development methodology...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo y học: "Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis" pps
... coronary angiography in the study by Weiss et al. showed a higher sensitivity and specificity for the detection of coronary stenosis by 3DMP than by 12-lead ECG [18]. One lim itation of the ... systems. In the case of the heart, analysis is performed on the signals emitted by the heart, such as the surface resting electrical signal recorded by an ECG....
Ngày tải lên: 08/08/2014, 16:23
Báo cáo y học: " Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis after coronary revascularization" doc
... nonobstructive coronary artery disease. Heart Dis. 2002; 4: 2-12. 22. Grube E, Bootsveld A, Yuecel S, et al. Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis. ... Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis after coronary revascularization Eberhard Gru...
Ngày tải lên: 08/08/2014, 17:20
Báo cáo y học: "Monoclonal Antibodies against Nucleophosmin Mutants: Potentials for the Detection of Acute Myeloid Leukemia" ppt
... Monoclonal Antibodies against Nucleophosmin Mutants: Potentials for the Detection of Acute Myeloid Leukemia Shi Tan 1 , Ling Zhang 1 , Xiao-Ming Zhong 1 , Zai-Lin Yang 2 , Liu-Yang Zhao 1 , Yu-Jie ... value of their detection by immunocytochemistry. Blood. 2002; 99: 409-26. 17. Falini B, Mecucci C, Tiacci E, et al. Cytoplasmic nucleophosmin in acute myelo...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo y học: " MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage" ppt
... No 1 Research article MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage Yu M Tan 1,2 , Mikkel ... despite there being no evidence of greater disease activity in terms of clinical scores (skin or joint) or inflammatory markers. Interestingly,...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "Soluble RAGE: a hot new biomarker for the hot joint" pdf
... membrane. J Rheumatol 1999, 26:2523-2528. 10. Yan SF, Ramasamy R, Naka Y, Schmidt AM: Glycation, inflam- mation and RAGE: a scaffold for the macrovascular complica- tions of diabetes and beyond. ... such as the following: Do plasma sRAGE levels vary from day to day in a subject? Do they vary over the lifespan of the individual? What were the levels of sRAGE in the RA subj...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: "Chondroitin and glucosamine sulfate in combination decrease the pro-resorptive properties of human osteoarthritis subchondral bone osteoblasts: a basic science study" pptx
... interpretation of data. HF and ML participated in acquisition of data. J-PP participated in analysis and interpretation of data and manuscript preparation. All authors read and approved the final manuscript. Acknowledgements The ... data, analysis and interpretation of data, manuscript preparation, and statistical analysis. JV and EM participated in study desig...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "Common interleukin-6 promoter variants associate with the more severe forms of distal interphalangeal osteoarthritis" pot
... study polymorphic effects on the synthesis of IL-6 have shown that its transcription and synthesis are affected by the allelic varia- tions within the gene, although the mechanism and level of the contribution ... in the light of the fact that both of these G alleles substantially increased the risk of symptomatic OA in our material. Individu- ally, the G allele o...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "T-614, a novel immunomodulator, attenuates joint inflammation and articular damage in collagen-induced arthritis" docx
... AGGGACAA-3' IFN-γ 5'-GAAAGACAACCAGGCCATCAG-3' 5'-TCATGAATGCATCCTTTTTTGC-3' IL-4 5'-CCACGGAGAACGAG CTCATC-3' 5'-GAGAACCCCAGACTTGTTCTTCA-3' IL-17 5'-GGGAAGTTGGACCACCACAT-3' ... infiltration and participate in a number of inflammatory and destructive events, such as synovial hyperplasia, pannus for- mation, cartilage and bone erosi...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... features include dextrocardia, L-transposition of the great arteries, abdominal situs inversus, bilateral (a) t TCTCCCTCCA...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: " Fluorodeoxyglucose-positron emission tomography/computed tomography in the staging and evaluation of treatment response in a patient with Castleman''''s disease: a case report" pps
... tomography/ computed tomography in the staging and evaluation of treatment response in a patient with Castleman's disease: a case report Ettore Pelosi* 1 , Andrea Skanjeti †2 , Angelina ... in a patient with a mediastinal mass. Then, other authors reported new cases of the disease with different localisations, including abdominal and s...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
... anti -Tax1 anti- The Tax1 (18 5-207) region negatively regulates the transforming activity of Tax1Figure 7 The Tax1 (18 5-207) region negatively regulates the transforming activity of Tax1. (A) The amino ... T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2 Toshiyuki Shoji 1, 2 , Masaya Higuchi 1 , Rie Kondo 1 , Masahiko T...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot
... Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan, 7 Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1-1 Murasaki-cho, Takatsuki, Osaka 569-1125, Japan, 8 Laboratory of Disease ... Hirofumi Akari 8 , Yoshio Koyanagi 9 , Jun Fujita 3 and Takashi Uchiyama 1 Address: 1 Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho...
Ngày tải lên: 13/08/2014, 05:21