Báo cáo y học: " Identification of a high incidence region for retroviral vector integration near exon 1 of the LMO2 locus" pot
Báo cáo y học: " Identification of a high incidence region for retroviral vector integration near exon 1 of the LMO2 locus" pot
... locus Koichiro Yamada 1 , Tomonori Tsukahara 1 , Kazuhisa Yoshino 1 , Katsuhiko Kojima 1 , Hideyuki Agawa 1 , Yuki Yamashita 1 , Yuji Amano 1 , Mariko Hatta 1 , Yasunori Matsuzaki 1 , Naoki Kurotori 1 , ... http://www.retrovirology.com/content/6 /1/ 79 Page 9 of 9 (page number not for citation purposes) 11 . Tsukahara T, Agawa H, Matsumoto S, Matsuda M, Ueno S, Yama...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps
... C-terminal portion of Vif was amplified using the for- ward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and the reverse primer VifR, 5'GGATAAACAGCAGT TGTTGC3'. ... 5'CAGGGAGATTCTAAAAG3', and the reverse primer YRHHYmutR, 5'CTTATTTTTGGATTAGTAC TTTCAGCGGCAGCTGCAGCAAACCAGTCCTTAGCTTTC C3', were used to ampli...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo hóa học: "Research Article A Geometrical-Based Model for Cochannel Interference Analysis and Capacity Estimation of CDMA Cellular Systems" pot
... have validated the accuracy of the model. In many cases, the results derived from the hexagonal model and the inradius circular approach were similar. The dependence of the capacity of a WCDMA ... of the probability of interference also. In order to validate the accuracy and reliability of the models, simulation results are presented. The pdfs in (1) and (...
Ngày tải lên: 21/06/2014, 23:20
Báo cáo hóa học: " Research Article A New Approximation Method for Solving Variational Inequalities and Fixed Points of Nonexpansive Mappings" docx
... of successive approximations for nonexpansive mappings,” Bulletin of the American Mathematical Society, vol. 73, pp. 5 91 597, 19 67. 7 R. T. Rockafellar, “On the maximality of sums of nonlinear ... nonlinear monotone operators,” Transactions of the American Mathematical Society, vol. 14 9, pp. 46–55, 2000. 8 H. K. Xu, “Iterative algorithms for nonlinear operators,”...
Ngày tải lên: 22/06/2014, 02:20
Báo cáo y học: "Soluble RAGE: a hot new biomarker for the hot joint" pdf
... arthritis synovial membrane. J Rheumatol 19 99, 26:2523-2528. 10 . Yan SF, Ramasamy R, Naka Y, Schmidt AM: Glycation, inflam- mation and RAGE: a scaffold for the macrovascular complica- tions of diabetes ... such as the following: Do plasma sRAGE levels vary from day to day in a subject? Do they vary over the lifespan of the individual? What were the levels of sRAGE i...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: " Is Ankyrin a genetic risk factor for psychiatric phenotypes?" pot
... 19 99, 323 :15 1 -15 5. Gella et al. BMC Psychiatry 2 011 , 11 :10 3 http://www.biomedcentral.com /14 71- 244X /11 /10 3 Page 4 of 5 41and42withdiseaseatadistanceof84.5kbto rs980 419 0 [10 ]. Ankyrin 3 is a brain expressed ... at recruitment of 42.5 years and 220 cases (13 4 males, 61% ) with unipolar depression (F32-F33). with an aver- age age at onset of 43 years and an average a...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: " Respiratory Research: a new multidisciplinary journal for a new age " doc
... primary articles. The full text of all primary research articles will, therefore, be widely available online free of charge, ensuring that all research findings are easily accessible to the respira- tory ... Jeffery Drazen of Harvard University, who was the North American Editor-in-Chief during the early stages when Respiratory Research was being set up. He played a very activ...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot
... Hirofumi Akari 8 , Yoshio Koyanagi 9 , Jun Fujita 3 and Takashi Uchiyama 1 Address: 1 Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho, ... the research, and analyzed the data. HH, KItoh, and JF designed the research, contributed vital new reagents, and analyzed the data. TU analyzed the data, drafted the paper, a...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: "Sequence homology: A poor predictive value for profilins cross-reactivity" ppt
... by a monoclonal antibody. J Biol Chem 19 96, 2 71: 29 915 -299 21. 30. Asturias JA, Gomez-Bayon N, Arilla MC, Sanchez-Pulido L, Valencia A, Martinez A: Molecular and structural analysis of the panal- lergen ... Proc Natl Acad Sci USA 19 87, 84:6 611 -6 615 . 24. Chapman MD, Smith AM, Vailes LD, Arruda LK, Dhanaraj V, Pomés A: Recombinant allergens for diagnosis and therapy of...
Ngày tải lên: 13/08/2014, 13:22
Báo cáo y học: " Landmark survival as an end-point for trials in critically ill patients – comparison of alternative durations of follow-up: an exploratory analysis" doc
... 1. 04 (1. 01 1. 07)* 1. 03 (1. 00 1. 05)* 1. 04 (1. 01 1. 07)* 1. 03 (1. 01 1. 05)* 1. 05 (1. 02 1. 08)* Organ score 1. 45 (1. 13 1. 85)* 1. 47 (1. 14 1. 89)* 1. 38 (1. 09 1. 74)* 1. 45 (1. 13 1. 85)* 1. 31 (1. 11 1. 54)* Trauma APACHE score 1. 28 (1. 16 1. 41) * 1. 28 (1. 16 1. 41) * 1. 25 (1. 15 1. 36)* 1. 22 (1. 13 1. 31) * 1. 18 (1. 12 1. 24)* 1. 13 (1. 05...
Ngày tải lên: 13/08/2014, 18:22