Báo cáo khoa học: "Vasopressin combined with epinephrine during cardiac resuscitation: a solution for the future" ppt
... retrospective studies? The pragmatic answer is yes. As already described, basic life support saves the ‘best’ cardiac arrest patients; any subsequent advanced cardiac life support intervention has a decreasing ... ventricular fibrillation victims, 75% of the Commentary Vasopressin combined with epinephrine during cardiac resuscitation: a solution for the future...
Ngày tải lên: 12/08/2014, 23:22
... of the linear energy transfer (LET) for different types of lethal damage in mammalian cells and for DNA damage. ILD, irrepairable lethal damage, derived as the contribution to the linear parameter ... g-ray irradiation. From these data the linear and quadratic parameters were derived by analysis with the formula S(D)/S(0) = exp-(aD+bD 2 ) for cell survival curves and F(D) =...
Ngày tải lên: 09/08/2014, 09:20
... protons with water and conformational rearrangements. The former is analyzed as the dynamics of the molecule is investigated at pH 6 in the free state. The data show that there are changes in the ... residues assignable in all three states are compared. Weights are calculated as for Fig. 3. On average, changes upon pH elevation are about twice as small as for complexation (a...
Ngày tải lên: 23/03/2014, 10:21
báo cáo khoa học: "Chest pain with ST segment elevation in a patient with prosthetic aortic valve infective endocarditis: a case report" ppsx
... Our patient had no previous history of angina, and was a non-smo- ker with no other cardiac risk factors. A coronary angio- gram performed five years ago prior to his valv e surgery revealed ... report Vishal Luther 1* , Refai Showkathali 2 and Reto Gamma 2 Abstract Introduction: Acute ST-segment elevation myoc ardial infarction secondary to atherosclerotic plaque rupture is a commo...
Ngày tải lên: 10/08/2014, 23:20
báo cáo khoa học: " Lung adenocarcinoma with giant cyst formation showing a variety of histologic patterns: a case report" pps
... performed on the pleural effusion and the tumor was diagnosed as a con- ventional adenocarcinoma (the cytological specimen is not available). The pleural effusion had been controlled by drainage and chemotherapy. ... cyst formation is rela- tively rare and only a few case s have been reported [1-6]. This report is from an autopsy of a patient with lung adenocarcinoma with lar...
Ngày tải lên: 11/08/2014, 02:22
Báo cáo khoa học: "Extracting loanwords from Mongolian corpora and producing a Japanese-Mongolian bilingual dictionary" ppt
... Fourth, as performed by Fujii et al. (2004), we use a Japanese Katakana dictionary and extract a candidate loanword that is phonetically similar to a Katakana word as a loanword. We romanize the ... Katakana words that are similar to the candidate loanwords. Then, we compute the phonetic similarities between each candidate loanword and each retrieved Katakana word using D...
Ngày tải lên: 23/03/2014, 18:20
Báo cáo khoa học: "Clostridium difficile-associated diarrhea in radiooncology: an underestimated problem for the feasibility of the radiooncological treatment" doc
... linear accelerator. Addi- tional hand hygiene with water and soap for all persons exiting the isolation room was performed as well as for the staff dealing with the patient at the linear accelera- tor. ... prophylactically. Isolation implicates a single room with a separate bathroom. Gloves and special gowns were used by the staff dealing with the patients on the...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: " Optimal organ-sparing intensity-modulated radiation therapy (IMRT) regimen for the treatment of locally advanced anal canal carcinoma: a comparison of conventional and IMRT plans" ppsx
... Bahoric B, Devic S: Conformal therapy improves the therapeutic index of patients with anal canal cancer treated with combined chemotherapy and external beam radiotherapy. Int J Radiat Oncol Biol Phys ... the small bowel, bladder, genitalia and femoral heads as compared to conventional AP/PA plans with 3D conformal boost. The mean values that we obtained for these critical stru...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo khoa hoc:" Development and assignment of bovine-specific PCR systems for the Texas nomenclature marker genes and isolation of homologous BAC probes" ppt
... they may not be the most appropriate markers for a standardisation effort. This panel of BACs is available to the scientific community and has served as a basis for the establishment of a revised ... establishment of the Texas nomenclature [14]. For RB1, heterologous primers: RB1F: CTTGTGTGATTAACTTATTTAGAG and RB1R: AATGTGAACTTAGTAGCAAAAGAC derived from the human sequence...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo khoa hoc:" Genetic diversity measures of local European beef cattle breeds for conservation purposes" pptx
... GCA TAC CCT ACA CC INRA 063 Vaiman et al. [51] P1: ATT TGC ACA AGC TAA ATC TAA CC 18 55 1.5 30 187–171 0.632 0.654 P2: AAA CCA CAG AAA TGC TTG GAA G TGLA 44 George et al. [15] P1: AAC TGT ATA ... TAT ATT TAA CCA C 4 55 1.5 30 144–114 0.628 0.687 P2: AAA ATT CCA TGG AGA GAG AAA C INRA 005 Vaiman et al. [50] P1: CAA TCT GCA TGA AGT ATA AAT AT 12 55 1.5 30 147–139 0.624 0.655 P2: CTT CAG ... ena...
Ngày tải lên: 09/08/2014, 18:21