0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: " Introduction of a rapid response system: why we are glad we MET" pps

Báo cáo khoa học:

Báo cáo khoa học: " Introduction of a rapid response system: why we are glad we MET" pps

... patients.Analysis of the circadian variation of activation of the METservice revealed that the majority of calls occurred duringnursing handover, with a peak at 8:00–8:30 hours [15]. Theseobservations ... intensive care admissions in Australia and NewTable 1Important components of the success of the MET service atThe Austin HospitalCollection of baseline data for before-and-after studiesObtaining ... questionnaires to assess staff attitudes and obstacles toMET useAssessing the circadian pattern of MET activations and cardiac arrestsOngoing audit of effectiveness of the METFeeding back effectiveness...
  • 3
  • 206
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx

... sentences as a testcorpus.4.2 Language model and paraphrase tableParaphrase generation tools based on SMT meth-ods need a language model and a paraphrase table.Both are computed on a training ... experiments, each paraphrase was evalu-ated by two native French evaluators.5 Comparison with a SMT decoderIn order to validate our algorithm for paraphrasegeneration, we compare it with an off-the-shelfSMT ... experiment, we have shown thatour algorithm with a biased paraphrase table isstate -of- the-art to generate paraphrases.6 Conclusions and further researchIn this paper, we have proposed a differentparadigm...
  • 4
  • 338
  • 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA25 ATATTATATATATATATAGGGTCGTATATA26 AAATTATAGAAAGCAGTAGA TAAAACAATG27 CTTCGAAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAAAGTTCAATTCATCATTTTTTTTTTATTCTTTT28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA4 CCCCGAATTCAAATTATAGAAAGCAGTAGA5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC6 AAAAGTCGACGAGCTCGTTTTCGACACTGG7 TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC8 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT9 ... TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC18 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA22...
  • 9
  • 444
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx

... This software tool not only allows for the separation of data and algorithms but also provides great flexibility in the organization of grammars and subgrammars, and in the control of the ... system, actual trans- lation takes place in transfer and can be descri- bed as the ocr~putaticnal manipulation of tree structures. In the absenoe of any formal theory of translation for MT, and ... Ger- man analysis is indirectly influenced by target language considerations: the interface structure between analysis and transfer was defined to take advantage of the similarities between the...
  • 4
  • 394
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Development of a RVFV ELISA that can distinguish infected from vaccinated animals" pps

... AA, Al-Rabeah AM,Turkistani AM, Al-Sayed MO, Abodahish AA, Khan AS, Ksiazek TG,Shobokshi O: Rift Valley fever epidemic in Saudi Arabia: epi-demiological, clinical, and laboratory characteristics[seecomment]. ... Rift Valley [5]. It is present throughout Africa,and has also caused outbreaks in Madagascar off the East-ern coast of Africa as well as in Yemen and Saudi Arabia[6].The virus is transmitted ... ng/well were coated onto EIA plates and allowed to absorb overnight. The assay was carried out as described in Methods. Endpoint titers against each antigen from a human case that was naturally...
  • 11
  • 279
  • 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... presence of both amorphous aggregates and fibrillar deposits.Fig. 5. Aggregation of a- synuclein after 240 h. Samples containingMPTP (A and C) and MPP+(B and D) were analysed by SDS ⁄ PAGE (A and ... Pharmaceutical Education and Research (NIPER), S .A. S. Nagar, India Introduction The inability of the cell to degrade various stable mis-folded proteins leads to the formation of aggregatesand ... as apparent rate constant) was accelerated. Thus,when a- synuclein was exposed to increasing concentra-tions of the neurotoxin, the rate of fibrillation wasenhanced. This may explain why acute...
  • 11
  • 754
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 ... CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x ... CAAGCAGGTGAATTAGGCSpcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x...
  • 16
  • 646
  • 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki Yoshida and Hirotake ... receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA,paraformaldehyde; Prox-1, prospero-related homeobox-1; SV40T Ag, SV40 large T antigen; tsA58T Ag, large...
  • 11
  • 873
  • 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... Free ligandswere adsorbed on charcoal, and the absorbance spectrawere recorded. Concentration of appearing IF–CNCbl wascalculated by comparison with the standards IF–H2OCbland IF–CNCbl according ... adenosylcobalamin inpatients diagnosed with various malignancies. MayoClin Proc 75, 568–580.4 Bagnato JD, Eilers AL, Horton RA & Grissom CB(2004) Synthesis and characterization of a cobalamin-colchicine ... University of Utah, Salt Lake City, UT, USA3 Department of Physiology and Biophysics, University of Aarhus, Denmark4 Department of Medical Biochemistry, University of Aarhus, Denmark5 Department of...
  • 12
  • 603
  • 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; NP5, 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream ... standard.Standard enzyme assaySPRK activity was routinely measured using Suc-Ala-Ala-Pro-Phe-pNA (Sigma Aldrich) as substrate. The peptidaseassay was carried out in a total volume of 250 lL, contain-ing...
  • 14
  • 523
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ