Báo cáo khoa học: " A Lung and ''''''''end organ'''''''' injury due to mechanical ventilation in animals: comparison between the prone and supine positions" pdf

Báo cáo khoa học: " A Lung and ''''end organ'''' injury due to mechanical ventilation in animals: comparison between the prone and supine positions" pdf

... prominent in the prone position. Transaminases (aspartate aminotransferase and alanine aminotransferase) increased during mechanical ventilation in the supine position, while they were bothunchanged ... overdistention and shear stress (barotrauma orvolutrauma) as well as mechanical damage due to the produc-tion, release and/ or activation of cytotoxic and inflammatorycascades (biotrauma). In addition to ... vein was cannulated, and anesthesiawas induced with katanine, maintained by continuous intrave-nous injection of midazolam and fentanyl citrate and paralyzedwith pancuronium bromide. The animals...

Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx

... 774agt_Arath 4 -a- glucanotransferase n.d. Arabidopsis thaliana AAL91204 955 774agt_Orysa 4 -a- glucanotransferase n.d. Oryza sativa BAC22431 922 77(Dark red of Fig. 2)agwdArath a- glucan water dikinase ... FEBS58 Nakamura Y, Kaneko T, Sato S, Mimuro M, MiyashitaH, Tsuchiya T, Sasamoto S, Watanabe A, KawashimaK, Kishida Y, Kiyokawa C, Kohara M, Matsumoto M,Matsuno A, Nakazaki N, Shimpo S, Takeuchi ... is the barley a- amylase that binds to rawstarch at a surface binding site on the catalyticdomain. This has been demonstrated by mutationalanalysis [15] and the site is seen as two critically...

Báo cáo khoa học: "A rare case of isolated wound implantation of colorectal adenocarcinoma complicating an incisional hernia: case report and review of the literature" pdf

... hernia and presented in the anterior abdom-inal wall. Tumour markers were negative and there was nointra-abdominal pathology. Wound implantation in anincisional scar after open surgery is rare, ... tis-sue the anterior abdominal wall was visualised. The twoincisional hernia sacs were each identified and freed fromtheir attachments to the anterior abdominal wall allowingpre-peritoneal access. ... scan and tumour markers were reported asnegative. At operation, a mass was found within the anterior abdominal wall complicating the incisional hernia. This mass was widely resected and a laparotomy...

Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot

... On the next day, the lysate was centrifuged asbefore to produce a supernatant SII and a pellet PII. The A 260of the SI and SII fractions was measured, and the amount of DNA present in the samples ... N-terminal and C-ter-minal domains of canonical H1 histones. As stated byHansen et al. [51], there are many structural features,such as lower binding energy, greater ﬂexibility and faster binding, ... shown to bind to chromatin in a verydynamic way, with a residence time that largelydepends on the structural features of the C-terminaldomain [49]. Arginine can bind more effectively to DNA and...

Báo cáo khoa học: A new rice zinc-ﬁnger protein binds to the O2S box of the a-amylase gene promoter pptx

... the amino acidswithin the binding domain of RAMY protein and analyzed the time course for the induction of RAMY a nd a- amylasemRNA by GA.Correspondence to Q. Yao, Shanghai Key Laboratory of AgriculturalGenetic ... prior to that of the Amy2 mRNA level in the GA-treated aleurone tissues. These data suggest thatRAMY may act as a trans-acting protein and is probablyinvolved in the GA-induced expression of the ... ofGAMyb at the mRNA level is upregulated by GA [7] and theincreaseintheGAMyb mRNA occurs before that ofAmy21 mRNA after GA treatment. In addition, GAMybspeciﬁcally binds to an Amy21 GARE, and transientexpression...

Báo cáo khoa học: A monoclonal antibody, PGM34, against 6-sulfated blood-group H type 2 antigen, on the carbohydrate moiety of mucin doc

... testedwere assigned to the appropriate acidic oligosaccha-ride-alditols, bearing either a sulfate or a sialic acidresidue, as well as having N-acetylgalactosaminitol(GalNAc-ol) at the reducing terminus ... the normal mucosa and carcinoma of the large intestine.Galactose oxidase-Schiff reaction and lectin stainings.Acta Pathol Jpn 35, 1409–1425.12 Ishihara K, Kurihara M, Eto H, Kasai K, Shimauchi ... roles. In the stomach, the protein parts of the surface and gland mucins are dif-ferent from each other: MUC5AC is the dominantmucin in surface mucus, and MUC6 is the dominantmucin in gland mucus...

Báo cáo khoa học: A nonribosomal peptide synthetase (Pes1) confers protection against oxidative stress in Aspergillus fumigatus ppt

... GGCCTCCCTAAGCTTCTGGACCTTTTCGCGTGTTGCTTCCGACATAGGAACGAGzeocin–pyrG forward GAATTCTCAGTCCTGCTCCTCGGCCzeocin–pyrG reverse GATATCGAATTCGCCTCAAACAATGNested forward GAGACCTAGGAAGCAATGTCTCCGCAACATTTGGCGACATGGTCTCATATNested reverse GAGACCGCGGAAGCTTCTGGACCTTTTCGCGTGTTGCTTCCGACATAGGANRP ... fumigatus actin forward CGAGACCTTCAACGCTCCCGCCTTCTACGTAspergillus fumigatus actin reverse GATGACCTGACCATCGGGAAGTTCATAGGA5¢ ﬂanking forward CTAGCTGGTGAAGCAATGTCTCCGCAACATTTGGCGACATGGTCTCATAT5¢ ... TCTGACTCCGTCGATAGCTAGCATpes1 A4 reverse CCAGATCCTCACGACTGATAAGCTCpes1C2forward GAGATCTAGATACCCATGCAGCCCTGTCpes1C2reverse GAGAAAGCTTGTCAACTTGAATGCGGGTAGGpes1E1-C1forward CGCTGGCGAACACATTATATGApes1E1-C1reverse...

Báo cáo khoa học: "A Non-negative Matrix Tri-factorization Approach to Sentiment Classiﬁcation with Lexical Prior Knowledge" potx

... classiﬁ-cation by labeling words. In AAAI.V. Ng, S. Dasgupta, and S. M. Niaz Ariﬁn. 2006. Ex-amining the role of linguistic knowledge sources in the automatic identiﬁcation and classiﬁcation ... A. Jadhav, A. Joshi, S. Chakrabarti, and P. Bhattacharyya. 2003. Question answeringvia bayesian inference on lexical relations. In ACL,pages 1–10.T. Sandler, J. Blitzer, P. Talukdar, and L. ... (Das and Chen, 2001) to semi-automated approaches (Hu and Liu, 2004;Zhuang et al., 2006; Kim and Hovy, 2004), and even an almost fully automated approach (Turney,2002). Most semi-automated approaches...

Báo cáo khoa học nông nghiệp " Replacing fertiliser N with rhizobial inoculants for legumes in Vietnam for greater farm profitability and environmental benefits " MS4 docx

... Extension and training of farmers and advisors Extension and training of farmers and advisors is a major focus of the project as a means of facilitating adoption of legume inoculation in Vietnam. The ... national legume inoculant program. At the institutional level, the gaps are capacity for medium-scale inoculant production and associated quality assurance (QA) as well as R&D and training ... Rhizobial strain maintenance There is a need to ensure that the rhizobial cultures used in inoculant production are maintained as authentic, pure strains that originate from the same source and are...

Báo cáo khoa học nông nghiệp " Replacing fertiliser N with rhizobial inoculants for legumes in Vietnam for greater farm profitability and environmental benefits " MS6 potx

... conducted in 10 main legume-growing areas in Vietnam, from the highlands in the North, to the Central Coast area to the highlands in the South and Mekong Delta. The provinces involved were Son La, ... U.S .A and Australia. However, physical and chemical analyses of a peat are only a partial assessement of its suitability as a carrier. Only a test related to growth and survival of rhizobia can ... (4–18%) at the remaining 18% of sites. The overall average increases in biomass yield and grain yield using the superior Australian strains were 30% and 29%, respectively. There were large...

Xem thêm