Báo cáo khoa học: "A CC and CXC chemokine levels in children with meningococcal sepsis accurately predict mortality and disease severity" pptx
Báo cáo khoa học: "A CC and CXC chemokine levels in children with meningococcal sepsis accurately predict mortality and disease severity" pptx
... in menin- gococcal disease. Conclusion Serum levels of CXC and CC chemokines in children in the ini- tial phase of meningococcal sepsis can predict disease sever- ity and outcome. Competing interests The ... microbial induced pro- Key messages • Extremely high levels of CC chemokines as well as CXC chemokines are found in sera from children in the init...
Ngày tải lên: 12/08/2014, 23:21
Tài liệu Báo cáo khoa học: A novel tachykinin-related peptide receptor of Octopus vulgaris – evolutionary aspects of invertebrate tachykinin and tachykinin-related peptide ppt
... third intracellular loop and the C-terminus, sug- gesting that phosphorylation is involved in the modula- tion of G protein coupling and receptor function [22]. The Asp110 and Asn337 in TM2 and ... in the salivary gland of octopuses (oct-TKs and eledoisin) and female mosquitoes (sialokinins), and not in other mollusks or insects that possess TKRPs [6,8]. Moreover, we cou...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt
... 2G RAM, our system only takes about 110 minutes and 30 minutes to do training on the ACE 2003 (~77k training in- stances) and 2004 (~33k training instances) data, respectively. (2) Further ... by allowing grammar-driven partial rule matching and other approximate matching mechanisms in the parse tree kernel calculation. Finally, it is worth noting that by introducing more in...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo khoa học: A new phospholipase A2 isolated from the sea anemone Urticina crassicornis – its primary structure and phylogenetic classification pptx
... analyzed and aligned with the vector nti software package (Invitro- gen). Amino acid numbering and cysteine positions are used in accordance with the standard numbering for PLA 2 s introduced ... and group II, with a single exception, a sea lamprey PLA 2 . Also, in UcPLA 2 there is a C-terminal truncation of six amino acids, including a cysteine, so the usual pair- ing between...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: "A Uniform Treatment of Pragmatic Inferences in Simple and Complex Utterances and Sequences of Utterances" pot
... published by Gar- land Publishing Inc., 1991. G. Hirst, S. McRoy, P. Heeman, P. Edmonds, and D. Horton. 1994. Repairing conversational mi- sunderstandings and non-understandings. Speech Communication, ... for default reasoning. Ar- tificial Intelligence, 13:81-132. B. Russell. 1905. On denoting. Mind n.s., 14:479- 493. reprinted in: Feigl H. and Sellars W. editors, Readings i...
Ngày tải lên: 08/03/2014, 07:20
Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx
... C-terminal domain could not associate with the middle domain, but associated with the middle-C-terminal domains, we used the middle-C-terminal domains as a binding partner of the C-terminal domain ... N- and C-terminal domains, and the interaction with the latter mediates the dimeric configuration of HSP90. Besides one in the N-terminal domain, an addi- tional client-binding site e...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf
... staining with the antitau antibody, AT8. Again significantly increased tau phosphorylation is shown to occur in cells transfected with tau/p25/Cdk5 (Fig. 3C, c) compared with cells transfected with ... Cdk5 interaction site without inducing the T-loop displacement necessary for kinase activation. Cdk5 phosphorylates the KSPXK sequence motif in a large number of proteins including N...
Ngày tải lên: 23/03/2014, 21:21
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx
... seed-storage proteins are composed of the two major globulins glycinin and b-conglycinin. They are folded and assembled into trimers in the ER, and then trans- ported and deposited in the protein storage ... results indicate that GmPDIM is an ER luminal protein. Association of GmPDIM with proglycinin and b-conglycinin a’ in the cotyledon GmPDIM has oxidative folding activity...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: A novel glycogen-targeting subunit of protein phosphatase 1 that is regulated by insulin and shows differential tissue distribution in humans and rodents pdf
... gaagcggacccagcgacttctgcgctgacgcggggcgggcgggagagaggaagagaggggagcgcggtggcgctgcgagctggccccgccggggaaggggctgcc -1 1 ATG TCC CGT GAG CGG CCC CCG GGC ACC GAC ATT CCC CGC AAC CTG AGC TTC ATC GCC GCG ... glycogen stores and GS activity in muscle, liver and adipose tis- sue. Glucose intolerance, hyperinsulinaemia and insulin resistance were also observed to develop with increasing age. These...
Ngày tải lên: 30/03/2014, 16:20
Báo cáo khoa học: "A comparison of clausal coordinate ellipsis in Estonian and German: Remarkably similar elision rules allow a language-independent ellipsis-generation module" pot
... stands for Gapping, Sub- gapping, and Stripping, respectively; g(g) + is re- cursively added for LDG; f = FCR; s = SGF; b = BCR. (2) GAPPING: Jüri lives in Tallinn and his children live g in ... reads articles and her sons thick books (10) Jüri elab Tartus ja Tallinnas _ g tema pojad Jüri lebt in Tartu und in Tallinn _ g seine Söhne Jüri lives in Tartu and in...
Ngày tải lên: 31/03/2014, 20:20