Báo cáo y học: " Modification of a loop sequence between -helices 6 and 7 of virus capsid (CA) protein in a human " pot
Báo cáo y học: " Modification of a loop sequence between -helices 6 and 7 of virus capsid (CA) protein in a human " pot
... Removal of arginine 332 allows human TRIM5alpha to bind human immunodeficiency virus capsids and to restrict infection. J Virol 20 06, 80 : 67 38 - 67 44. 28. Nakayama EE, Miyoshi H, Nagai Y, Shioda T: A ... Nakayama EE, Yokoyama M, Sato H, Levy JA, Shioda T: A sin- gle amino acid of the human immunodeficiency virus type 2 capsid affects its replication in the presen...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo y học: " Collapse-to-emergency medical service cardiopulmonary resuscitation interval and outcomes of out-of-hospital cardiopulmonary arrest: a nationwide observational study" pdf
... orotracheal intubation was included as a sanctioned method of clearing airways by Emergency Life-Saving Technicians (ELSTs) with 262 hours of additional national standard training. Adrena- line administ ... Hiraide A, Nakanishi N, Hayashi Y, Nishiuchi T, Yukioka H, Yoshiya I, Sugimoto H: Age and sex analyses of out -of- hospital cardiac arrest in Osaka, Japan. Resuscitation 200...
Ngày tải lên: 14/08/2014, 08:21
Báo cáo y học: "2010 International consensus algorithm for the diagnosis, therapy and management of hereditary angioedema" pdf
... as HAE and should be replaced as soon as possible with large phase III and IV clinical trials, meta analyses, and using data base registry validation of approaches including quality of life and ... Canada. 30 Department of Medicine, University of Manitoba, Winnipeg, Manitoba, Canada. 31 University of Auckland, Auckland, New Zealand. 32 Department of Internal Medicine, Univ...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "he Alcohol Use Disorders Identification Test (AUDIT): reliability and validity of the Greek version" docx
... what was normally expected from you because of drinking? 0. 471 9 0. 76 5 7 0. 577 1 0. 76 8 How often during the last year have you needed a first drink in the morning to get yourself going after a heavy ... Discussion AUDIT has a high level of in ternal consistency and high reliability and validity in relation to clinical diagnosis. It detects 97% of patients and...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Adalimumab clinical efficacy is associated with rheumatoid factor and anti-cyclic citrullinated peptide antibody titer reduction: a one-year prospective study" potx
... baseline and after 6 and 12 months of adalimu- mab treatment. The sera of the control group of patients with RA were analyzed twice with a 1-year interval. Table 2 Clinical characteristics of patients ... received non-steroidal anti-inflammatory drugs and/ or analgesics, and 6 received other drugs. Patients were followed clinically at reg- ular intervals by the same physi...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "ronchogenic cyst associated with pericardial defect: Case report and review of the literature." pptx
... cysts: always easy? Asian Cardiovasc Thorac Ann 2009, 17: 4 67 -71 . 31. Lang-Lazdunski L, Pilling J: Videothoracoscopic excision of mediastinal tumors and cyst using the harmonic scalpel. Thorac Cardiovasc ... Ishikawa N, Ogata K: [Case of mediastinal bronchogenic cyst associated with partial pericardial defect and cured by excision.]. Kyobu Geka 1 963 , 16: 46- 50. 20. Marushkin AV...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line" pptx
... Salzman AL, Szabo C: Peroxynitrite- mediated DNA strand breakage activates poly-adenosine diphosphate ribosyl synthetase and causes cellular energy depletion in macrophages stimulated with bacterial ... A role of poly (ADP-ribose) polymerase in NF- kappaB transcriptional activation. Biol Chem 1999, 380:953-9. 38. Kannan P, Yu Y, Wankhade S, Tainsky MA: PolyADP-ribose polymerase is...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: " Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line." pptx
... Veres B, Gallyas F Jr, Varbiro G, et al: Decrease of the inflammatory response and induction of the Akt /protein kinase B pathway by poly- (ADP-ribose) polymerase 1 inhibitor in endotoxin-induced ... results indica te that PARP-1 serves as a repressing factor of the heat shock response by reg- ulating the expression of HSP -70 . Both protein- protein interaction and catalyti...
Ngày tải lên: 11/08/2014, 06:22
Báo cáo y học: " Post-transcriptional control by bacteriophage T4: mRNA decay and inhibition of translation initiation" pdf
... regions b Δ G c RB14 UUUUAAUUUAUAAAUACCUCCUAUAAAUACUUAGGAGGUAUUAUGAAUAUAUUU -18.9 RB69 UCCUAUAAGUAAUAAAUACCUCCUAUAAACGUGGGAGGUAUUAUGAAUAUAUUU - 16. 3 T4, others UUUAAUUUUAUAAAUACCUUCUAUAAAUACUUAGGAGGUAUUAUGAAUAUAUUU -14 .7 CC31 GAAUGCUAAAUAAAUACUCCUAUCAACUGAUAGGAGGUCCUCAUGGACAUUUUU -12.2 ... CC31 GAAUGCUAAAUAAAUACUCCUAUCAACUGAUAGGAGGUCCUCAUGGACAUUUUU -12.2 CUUAGGAGGUAUUAUG...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: "Mannose-binding lectin does not explain the course and outcome of pregnancy in rheumatoid arthritis" pot
... the accuracy of the data analysis. FG, MW, YM, AD, MH and RD designed the study. FG, MW and YM were involved in the acquisition of the data. FG, MW, SW, MH and RD analyzed the matrix-assisted laser ... desorption/ionization time of flight mass spectrometry data and interpreted the data. The manuscr ipt was prepared by FG, MW, SW, YM, AD, MH and RD. FG and SW did the statis...
Ngày tải lên: 12/08/2014, 15:22