Báo cáo y học: " Genotyping of TRIM5 locus in northern pig-tailed macaques (Macaca leonina), a primate species susceptible to Human Immunodeficiency Virus type 1 infection" pps

Báo cáo y học: " Genotyping of TRIM5 locus in northern pig-tailed macaques (Macaca leonina), a primate species susceptible to Human Immunodeficiency Virus type 1 infection" pps

Báo cáo y học: " Genotyping of TRIM5 locus in northern pig-tailed macaques (Macaca leonina), a primate species susceptible to Human Immunodeficiency Virus type 1 infection" pps

... ……cggggtttccccatggttaggctcgtctagaactcctgacctcaggtgatccacccgcctcggcctgcc aaagtgctgggattacaggcatgagctaccgcgcccagcctgtgcttattttcttaaaataatttttgtgg ctttgcag/ACGCTGCCGCCGAGGAAAGTCCTGTACTACTAGCCATGGTCAACCCTACCGTGTTCTTCGAC ATTGCCGTCGACGGCGAGCCCTTGGGCCGCGTCTCCTTCGAGCTGTTTGCAGACAAGGTTCCAAAGACAGC AGAAAATTTTCGTGCTCTGAGCACTGGAGAGAAAGGATTTGGTTATAAGGGCTCCTGCTTTCACAGAATTA TTCCAGGGTTTATGTGTCAGGGTGGTAACTTCAC...

Ngày tải lên: 12/08/2014, 23:21

12 241 0
Báo cáo y học: "Treatment of psychotic symptoms in bipolar disorder with aripiprazole monotherapy: a meta-analysis" pps

Báo cáo y học: "Treatment of psychotic symptoms in bipolar disorder with aripiprazole monotherapy: a meta-analysis" pps

... percentage). Trial Target Overall side effects Anxiety Agitation Acathisia Constipation Headache Hyperprolactinaemia Insomnia Nausea Sedation CN138-009 Mania 8 1 9 7 5 -6 6 13 15 CN138-074 Mania 6 ... weeks 12 weeks Total LE AE CW Total LE AE CW Total LE AE CW Total LE AE CW Total LE AE CW CN138-009 76 23 11 25 10 4 53 13 38 CN138-074 58 12 12 34 64 28 10 26 CN138 -13 5 82 9 23 1...

Ngày tải lên: 08/08/2014, 23:21

10 548 0
Báo cáo y học: " Treatment of forefoot problems in older people: study protocol for a randomised clinical trial comparing podiatric treatment to standardised shoe advi" potx

Báo cáo y học: " Treatment of forefoot problems in older people: study protocol for a randomised clinical trial comparing podiatric treatment to standardised shoe advi" potx

... Development and validation of a questionnaire to assess disabling foot pain. Pain 2000, 85 :10 7 -11 3. 18 . Roddy E, Muller S, Thomas E: Defining disabling foot pain in older adults: further examination of ... with an assessment which includes medical history, detailed analysis of the anatomical relationships within the foot and both a postural and a gait analysis [12 ]. Tre...

Ngày tải lên: 10/08/2014, 21:24

8 330 0
Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

... CST4 Inter-alpha-trypsin inhibitor heavy chain H1* ITIH1 5 Inter-alpha-trypsin inhibitor heavy chain H2 † ITIH2 5 Inter-alpha-trypsin inhibitor heavy chain H4 † ITIH4 5 Lipocalin 1* LCN1 5 Similar ... 5 Similar to Lipocalin 1 Lipocalin 2 LCN2 Latexin † LXN Prosaposin † PSAP Alpha -1- antitrypsin* SERPINA1 5 Alpha -1- antichymotrypsin* SERPINA3 2,5 Leukocyte elastase inhibitor* SERPINB1 5...

Ngày tải lên: 14/08/2014, 17:22

11 289 0
Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"

Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"

... (CHOL), alanine amino- transferase (ALT), aspartate aminotransferase (AST), albumin (Alb), globulin (Glb), HBV DNA, body mass index (BMI), homeostatic model assessment of insulin resistance (HOMA-IR) ... results of binary logistic regression are shown in Table 3. Among all indices and laboratory characteristics, FINS was the only characteristic that strongly associated with hepatic...

Ngày tải lên: 25/10/2012, 11:48

6 606 0
Báo cáo y học: "Management of HBV Infection in Liver Transplantation Patients"

Báo cáo y học: "Management of HBV Infection in Liver Transplantation Patients"

... contributing to the efficacy of combination LAM and HBIG remain poorly defined. Postulated mechanisms include the synergy of: 1) LAM reducing HBV replication and altering synthesis of HBsAg necessary ... Transplantation at Cedars-Sinai Medical Center. His basic and translational research interests involve the immunological and inflammatory mechanisms of pathogenesis in alloimmu...

Ngày tải lên: 02/11/2012, 11:17

9 671 0
Báo cáo Y học: Inhibition of hyaluronan synthesis in Streptococcus equi FM100 by 4-methylumbelliferone doc

Báo cáo Y học: Inhibition of hyaluronan synthesis in Streptococcus equi FM100 by 4-methylumbelliferone doc

... P., Yamada, Y. , Imagawa, M., Shinomura, T., Hamaguchi, M., Yoshida, Y. , Ohnuki, Y. , Miyauchi, S., Spicer, A. P., McDonald, J .A. & Kimata, K. (19 99) Three isoforms of mammalian hyaluronan synthases ... regulation of tumour-associated hyaluronan. CIBA Found. Symp 13 , 15 0 15 9. 5. Kosaki, R., Watanabe, K. & Yamaguchi, Y. (19 99) Over- production of hyaluronan by expre...

Ngày tải lên: 08/03/2014, 09:20

10 541 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

... half-reaction of Y2 38 mutants with D -alanine was measured by mixing anaerobically a solution of each mutant enzyme with solutions containing varying concen- trations of D -alanine, such that ... the Y2 38 mutants to catalyse D -alanine/ oxygen catalysis was measured by enzyme-monitored turnover [ 21] . Air-saturated solutions of Y2 38 mutant enzymes and of D -alanine were m...

Ngày tải lên: 17/03/2014, 17:20

10 496 0
Báo cáo Y học: Role of histidine 42 in ascorbate peroxidase Kinetic analysis of the H42A and H42E variants pptx

Báo cáo Y học: Role of histidine 42 in ascorbate peroxidase Kinetic analysis of the H42A and H42E variants pptx

... peroxidase activity was first reported in 19 79 [9 ,10 ] and the enzyme catalyses the reduction of potentially damaging H 2 O 2 in plants and algae using ascorbate as a source of reducing equivalents [11 ,12 ]. ... recombinant wild -type pea cytosolic APX; H4 2A, a variant of rAPX in which His42 has been replaced with alanine; H42E, a variant of rAPX in which His42 has...

Ngày tải lên: 18/03/2014, 01:20

11 469 0
Báo cáo y học: "Role of Genetic Polymorphisms in Therapeutic Response to Anti-Asthma Therapy" pot

Báo cáo y học: "Role of Genetic Polymorphisms in Therapeutic Response to Anti-Asthma Therapy" pot

... one, as once understood, we may be able to rely on a patient’s genetics to aid in choosing the most appropriate therapy. As clinicians attempting to stay current in the evolving science of asthma, ... loci may play a simultaneous role in response to pharmacother- apy. Future research regarding the mysteries of asthma will focus on not only phenotypic indicators but also...

Ngày tải lên: 08/08/2014, 21:20

3 387 0
Từ khóa:
w