Báo cáo khoa học: "Evidence-Based Medicine Journal Club EBM Journal Club Section Editor: Eric B. Milbrandt, MD, MPH" ppt

... 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 9903 10318 415 C. Gijavanekar et al. PCR detection of nearly any dengue ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT...

Ngày tải lên: 14/02/2014, 19:20

... of inhibition by cyclophilin D was evident in the form of slightly increased respiration rates during arsenolysis. However, the modulation of F 0 F 1 -ATP synthase by cyclophilin D did not increase the adenine ... that the modulation of F 0 F 1 -ATP synthase activity by CYPD comprises an ‘in-house’ mechanism of regulating matrix adenine nucleotide le...

Ngày tải lên: 14/02/2014, 19:20

... in antiapoptotic effect of Hsp70 B. Jiang et al. 650 FEBS Journal 277 (2010) 642652 ê 2009 The Authors Journal compilation ê 2009 FEBS Nucleolin/C23 mediates the antiapoptotic effect of heat shock ... among the regulation of nucleo- lin ⁄ C23, the activation of caspase-3 and the induction of apoptosis under the setting of oxidative stress and Hsp70...

Ngày tải lên: 16/02/2014, 09:20

... Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D 2 in vivo Yasushi Fujitani 1, *, Kosuke Aritake 1 , ... more in WAT of TG mice than in WAT of WT mice. Serum levels of triglyceride, glucose, leptin and insulin, and insulin sensitivity, in TG mice After 6 weeks of normal or HF diet, serum level...

Ngày tải lên: 16/02/2014, 09:20

... solvent-accessi- ble and hence restrict cutting in this area. Cleavage site specificity To gain a better understanding of the cleavage site specificities of the three MMPs, the active sites were modeled ... Tropoelastin degradation by elastinolytic MMPs FEBS Journal 277 (2010) 19391956 ê 2010 The Authors Journal compilation ê 2010 FEBS 1941 Degradation of tropoelasti...

Ngày tải lên: 16/02/2014, 14:20

... di, tiec nudi Idn nha't eua NgQdi la "sudt ddi tdi het Idng het sQc phuc vu To qudc, phuc vu each mang, phuc vu nhan dan. Nay du phai tQ biet the gidi nay, tdi khdng ed dieu ... yeu cua NgQdi dd'i vdi nhan dan, vdi thien nhien. Mdi dieu Hd Chf Minh tran trd, dan lai trong Di chuc deu chQa chan ta'm Idng mdt hien nhan dd'i vdi eon ngQdi, vdi t...

Ngày tải lên: 17/02/2014, 05:20

... preloaded in vivo with ETA intraluminally processed and extraluminally released intact ETA and ETA -A < /b> in vitro in a < /b> pH-dependent and ATP-dependent manner. Rat hepatic < /b> cells underwent in vivo intrinsic ... hepatic < /b> endosomes < /b> by < /b> cathepsins < /b> B and D produces fragments displaying in vitro ADP-ribosylating and apop...

Ngày tải lên: 18/02/2014, 04:20

... existing in faeces from the skunk silkworm, Bombyx mori. J Sericult Sci Japan 47, 161–165. 6 Inokuchi T & Yoshitake N (1978) Abnormality of amino acid metabolism in the mutant -skunk of the K. ... acts in the third step of leucine degradation and the sku mutant accumulates branched-chain amino acids in haemolymph, this mutant may be useful in the...

Ngày tải lên: 18/02/2014, 04:20

... http://genomemedicine.com/content/2/11/83 doi:10.1186/gm204 Cite this article as: Orešič M, et al.: Systems medicine and the integration of bioinformatic tools for the diagnosis of Alzheimer’s ... avenues. Bioinformatics tools enabling a systems medicine approach to AD Many tools are available for mining of heterogeneous biological data, although the...

Ngày tải lên: 11/08/2014, 12:21

... 29:101-113. doi:10.1186/gm220 Cite this article as: Auray C, et al.: Genome Medicine: past, present and future. Genome Medicine 2011, 3:6. Auray et al. Genome Medicine 2011, 3:6 http://genomemedicine.com/content/3/1/6 Page ... mean ing to this public desire and still carry out big genomic studies? e research on how people respond to â 2010 BioMed Central Ltd Genome...

Ngày tải lên: 11/08/2014, 12:21

... use of specic cell types produced from human â 2010 BioMed Central Ltd Genome Medicine: stem cells, genomics and translational research Stuart H Orkin* E D I T O R I A L *Correspondence: stuart_orkin@dfci.harvard.edu ... articles on stem cell genomics to be published in this and upcoming issues of Genome Medicine. ese contributions sample just a few of the many exciting...

Ngày tải lên: 11/08/2014, 12:21

... specicities of local economies and health systems. Systems medicine and integrated care to combat chronic noncommunicable diseases Jean Bousquet 1 *, Josep M Anto 2 , Peter J Sterk 3 , Ian M ... Genome Medicine 2011, 3:43 http://genomemedicine.com/content/3/7/43 doi:10.1186/gm259 Cite this article as: Bousquet J, et al.: Systems medicine and integrated care...

Ngày tải lên: 11/08/2014, 12:21

... Evidence-Based Medicine Journal Club EBM Journal Club Section Editor: Eric B. Milbrandt, MD, MPH Journal club critique The routine use of albumin for fluid resuscitation of critically ill patients ... Care Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA 2 Assistant Professor, Department of Critical Care Medicine, Unive...

Ngày tải lên: 12/08/2014, 20:20

... Broderick J, Davis S, Diringer MN, Skolnick BE, Steiner T: Recombinant activated factor VII for acute intracerebral hemorrhage. N Engl J Med 2005, 352:777-785. 2. Qureshi AI, Tuhrim S, Broderick ... Broderick JP, Brott TG, Duldner JE, Tomsick T, Huster G: Volume of intracerebral hemorrhage. A powerful and easy-to-use predictor of 30-day mortality. Stroke 1993, 24:987-993. 4. Frieder...

Ngày tải lên: 12/08/2014, 23:21

... greatly influencing intensivists and rapidly became the standard of care [14]. The Corticosteroid Therapy of Septic Shock (CORTICUS) study evaluated the efficacy and safety of low-dose hydrocortisone ... who received hydrocortisone. New infection, hypernatremia and hyperglycemia occurred more frequently in the hydrocortisone group compared to placebo. CORTICUS is the largest study to...

Ngày tải lên: 13/08/2014, 18:22