Báo cáo y học: "Tracing the HIV-1 subtype B mobility in Europe: a phylogeographic approach" doc
Báo cáo y học: "Tracing the HIV-1 subtype B mobility in Europe: a phylogeographic approach" doc
... d.vandevijver@erasmusmc.nl; Jan Albert - jan.albert@smi.ki.se; Guiseppe Angarano - g.angarano@unifg.it; Birgitta Åsjö - Birgitta.Asjo@gades.uib.no; Claudia Balotta - claudia.balotta@unimi.it; Enzo Boeri - boeri.enzo@hsr.it; ... Liitsola K, Tashkinova I, Laukkanen T, Korovina G, Smolskaja T,Momot O, Mashkilleyson N, Chaplinskas S, Brummer-KorvenkontioH, Vanhatalo J, et al.: HIV-1 < /b> genetic subtype < /b> A /B recombinantstrain causing ... performed the < /b> analysis and pre-pared the < /b> manuscript, OP, GM and AH designed part of the < /b> analysis, AMJW and DAV collected the < /b> data and coor-dinated CATCH and SPREAD studies, JA, GA, B , CB, EB,RC,...
- 11
- 577
- 0
Báo cáo y học: " Tracing the evolution of tissue identity with microRNAs" ppt
... deuterostomes. In addition, although acoels are believed to primitively lack a real brain, having instead a simple ‘commissural’ brain characterized by transverse fiber accumulation in the < /b> head, without ... Platyhelminthes but have recently been placed at a key position at the < /b> base of the < /b> Bilateria on the < /b> basis of new molecular data [9] (Figure 1). Earlier studies revealed that the < /b> highly conserved ... Grimson A, Srivastava M, Fahey B, Woodcroft BJ, Chiang HR, King N, Degnan BM, Rokhsar DS, Bartel DP: Early origins and evolution of microRNAs and Piwi-interacting RNAs in animals. Nature 2008,...
- 4
- 299
- 0
Báo cáo y học: " Does the viral subtype influence the biennial cycle of respiratory syncytial virus?" pptx
... FAM-ACACCATCCAACGGAGCACAGGAGA-TAMRA.RSV B (N gene)f: AAGATGCAAATCATAAATTCACAGGAr: TGATATCCAGCATCTTTAAGTATCTTTATAGTGprobe: FAM-AGGTATGTTATATGCTATGTCCAGGTTAG-GAAGGGAA-TAMRA.Statistical analysis ... caused by respiratory syncytial virus in Croatia in 2006 and 2007 by viral subtype < /b> and ageFigure 1Bronchiolitis and pneumonia (No.) caused by respiratory syncytial virus in Croatia in 2006 and ... began circulating at the < /b> same time, but subtype < /b> A activity terminated slightly earlier (Figure 2). In the < /b> first,smaller outbreak in 2006, the < /b> activity of subtype < /b> A wasfairly constant over an...
- 7
- 321
- 0
Tài liệu Báo cáo Y học: Dissecting the effect of trifluoroethanol on ribonuclease A Subtle structural changes detected by nonspecific proteases ppt
... were calculated from the < /b> linearincrease of absorbance. Each value given in Fig. 4 is the< /b> average of three independent measurements ± SD.Proteinase K activity assayProteinase K activity was determined ... of the < /b> proteolytic degradation of RNase A bysubtilisin Carlsberg (upper panel) and proteinase K (lower panel) in trifluoroethanol. RNase A was incubated in the < /b> presence of subtilisinCarlsberg ... phenylmethanesulfonylfluoride was from Merck, and N-succinyl-Ala-Ala-Ala-p-nitroanilide from Bachem. All other chemicals were the< /b> purest ones commercially available.Determination of RNase A concentration The < /b> protein concentration...
- 7
- 492
- 0
Báo cáo y học: "Evaluating the Safety of Intranasal Steroids in the Treatment of Allergic Rhinitis" docx
... the < /b> safety standards set by the < /b> currently availabletherapies for AR. Understanding the < /b> potential concernsand the < /b> data behind these concerns should give clinicians the < /b> information to be able to ... ocular safety, and the < /b> use of INCs concomitantly with inhaled corticosteroids in asthma patients. As all clinicians are aware, each patient can have individual responses to both efficacy and safety; ... Suppl):S179–90.13. Galant SP, Melamed IR, Nayak AS, et al. Lack of effect offluticasone propionate aqueous nasal spray on the < /b> hypothalamic-pituitary-adrenal axis in 2- and 3-year-old patients. Pediatrics2003;112(1...
- 5
- 395
- 0
Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf
... mighthave immune-modulatory potential. Five statins arecurrently available within the < /b> UK: pravastatin, simvastatin,fluvastatin, atorvastatin and rosuvastatin; in addition,lovastatin is available ... potential benefits ofstatin therapy on inflammatory airway disease. After primingand intra-nasal ovalbumin challenge, reductions in inflammatory cell infiltrate and eosinophilia in broncho-alveolar ... andimmune-modulatory effects might have utility in diseasestates beyond atherogenesis. Sparrow and colleaguesdemonstrated that simvastatin had a comparable anti-inflammatory effect to that of indomethacin...
- 7
- 334
- 0
Báo cáo y học: "Comparing the prevalence of rheumatic diseases in China with the rest of the world" pptx
... rheumatoidarthritis, many of these studies only detected a few cases in a community, so the < /b> estimate of prevalence is accompanied bywide confidence bounds, and there was substantial variation in ... informative, especially since rheumaticdiseases vary in prevalence by age. An additional source ofEditorialComparing the < /b> prevalence of rheumatic diseases in China with the < /b> rest of the < /b> worldDavid T FelsonClinical ... obesity, gout is becoming endemic in China.Finally, symptomatic knee osteoarthritis is extremely common in China and constitutes a major public health problem there. In the < /b> present issue of Arthritis...
- 2
- 313
- 0
Báo cáo y học: "Rituximab therapy reduces activated B cells in both the peripheral blood and bone marrow of patients with rheumatoid arthritis: depletion of memory B cells correlates with clinical response" potx
... rituximab. Rheumatology(Oxford) 2005, 44:176-182.31. Tokunaga M, Saito K, Kawabata D, Imura Y,< /b> Fujii T, Nakayamada S,Tsujimura S, Nawata M, Iwata S, Azuma T, Mimori T, Tanaka Y:< /b> Efficacy of ... results,according to the < /b> following equation:ResultsClinical characteristics of the < /b> patients and response to rituximab therapy The < /b> clinical and laboratory characteristics of the < /b> RA patientswho ... observed in the < /b> BM.Importantly, rituximab therapy preferentially depleted activatedCD19+HLA-DR+ B cells in both compartments. The < /b> relativelow clinical response rate in our population probably...
- 8
- 376
- 0
Báo cáo y học: "Mapping the complexity of transcription control in higher eukaryotes" docx
... the < /b> drawbacks of the < /b> two methods [4].Drosophila embryonic development is particularly amenable to analysis by both in situ hybridization and microarray analysis. Large numbers of approximately ... transcription factor database. Nucleic Acids Res 2010, 38:D443-D447.6. Ravasi T, Suzuki H, Cannistraci CV, Katayama S, Bajic VB, Tan K, Akalin A, Schmeier S, Kanamori-Katayama M, Bertin N, Carninci ... B, Teichmann SA, Arakawa T, Ninomiya N, et al.: An atlas of combinatorial transcriptional regulation in mouse and man. Cell 2010, 140:744-752.7. Noyes MB, Christensen RG, Wakabayashi A, Stormo...
- 4
- 265
- 0
Báo cáo y học: "Quantifying the mechanisms of domain gain in animal proteins" doc
... Open AccessQuantifying the < /b> mechanisms of domaingain in animal proteinsMarija Buljan*, Adam Frankish, Alex BatemanAbstractBackground: Protein domains are protein regions that are shared among ... gained domainsWhen a new domain was encoded by a first or lastcoding exon, the < /b> gain was called as an amino- or car-boxy-terminal gain, respectively. In addition, when aninserted domain was ... confidence)setbyexcludingtwooutofthethreefilteringcriteria(Additional file 2a) . We left only the < /b> criteria for domaingainstobesupportedbyagaininanorganismwithabetter quality genome, because the < /b> distribution ofdomain gains...
- 15
- 385
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam