Báo cáo y học: "Tracing the HIV-1 subtype B mobility in Europe: a phylogeographic approach" doc

Báo cáo y học: "Tracing the HIV-1 subtype B mobility in Europe: a phylogeographic approach" doc

Báo cáo y học: "Tracing the HIV-1 subtype B mobility in Europe: a phylogeographic approach" doc

... d.vandevijver@erasmusmc.nl; Jan Albert - jan.albert@smi.ki.se; Guiseppe Angarano - g.angarano@unifg.it; Birgitta Åsjö - Birgitta.Asjo@gades.uib.no; Claudia Balotta - claudia.balotta@unimi.it; Enzo Boeri - boeri.enzo@hsr.it; ... Liitsola K, Tashkinova I, Laukkanen T, Korovina G, Smolskaja T, Momot O, Mashkilleyson N, Chaplinskas S, Brummer-Korvenkontio H, Vanhatalo J, et al.: HIV-1 < /b> gen...

Ngày tải lên: 12/08/2014, 23:21

11 577 0
Báo cáo y học: " Tracing the evolution of tissue identity with microRNAs" ppt

Báo cáo y học: " Tracing the evolution of tissue identity with microRNAs" ppt

... deuterostomes. In addition, although acoels are believed to primitively lack a real brain, having instead a simple ‘commissural’ brain characterized by transverse fiber accumulation in the < /b> head, without ... Platyhelminthes but have recently been placed at a key position at the < /b> base of the < /b> Bilateria on the < /b> basis of new molecular data [9] (Figure 1). E...

Ngày tải lên: 09/08/2014, 20:21

4 299 0
Báo cáo y học: " Does the viral subtype influence the biennial cycle of respiratory syncytial virus?" pptx

Báo cáo y học: " Does the viral subtype influence the biennial cycle of respiratory syncytial virus?" pptx

... FAM-ACACCATCCAACGGAGCACAGGAGA- TAMRA. RSV B (N gene) f: AAGATGCAAATCATAAATTCACAGGA r: TGATATCCAGCATCTTTAAGTATCTTTATAGTG probe: FAM-AGGTATGTTATATGCTATGTCCAGGTTAG- GAAGGGAA-TAMRA. Statistical analysis ... caused by respiratory syncytial virus in Croatia in 2006 and 2007 by viral subtype < /b> and ageFigure 1 Bronchiolitis and pneumonia (No.) caused by respiratory syncytial virus in Cro...

Ngày tải lên: 12/08/2014, 04:20

7 321 0
Tài liệu Báo cáo Y học: Dissecting the effect of trifluoroethanol on ribonuclease A Subtle structural changes detected by nonspecific proteases ppt

Tài liệu Báo cáo Y học: Dissecting the effect of trifluoroethanol on ribonuclease A Subtle structural changes detected by nonspecific proteases ppt

... were calculated from the < /b> linear increase of absorbance. Each value given in Fig. 4 is the < /b> average of three independent measurements ± SD. Proteinase K activity assay Proteinase K activity was determined ... of the < /b> proteolytic degradation of RNase A by subtilisin Carlsberg (upper panel) and proteinase K (lower panel) in trifluoroethanol. RNase A was incubated in...

Ngày tải lên: 22/02/2014, 07:20

7 492 0
Báo cáo y học: "Evaluating the Safety of Intranasal Steroids in the Treatment of Allergic Rhinitis" docx

Báo cáo y học: "Evaluating the Safety of Intranasal Steroids in the Treatment of Allergic Rhinitis" docx

... the < /b> safety standards set by the < /b> currently available therapies for AR. Understanding the < /b> potential concerns and the < /b> data behind these concerns should give clinicians the < /b> information to be able to ... ocular safety, and the < /b> use of INCs concomitantly with inhaled corticosteroids in asthma patients. As all clinicians are aware, each patient can have in...

Ngày tải lên: 08/08/2014, 21:20

5 396 0
Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf

Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf

... might have immune-modulatory potential. Five statins are currently available within the < /b> UK: pravastatin, simvastatin, fluvastatin, atorvastatin and rosuvastatin; in addition, lovastatin is available ... potential benefits of statin therapy on inflammatory airway disease. After priming and intra-nasal ovalbumin challenge, reductions in inflammatory cell infiltrate and eosinophilia...

Ngày tải lên: 09/08/2014, 06:22

7 334 0
Báo cáo y học: "Comparing the prevalence of rheumatic diseases in China with the rest of the world" pptx

Báo cáo y học: "Comparing the prevalence of rheumatic diseases in China with the rest of the world" pptx

... rheumatoid arthritis, many of these studies only detected a few cases in a community, so the < /b> estimate of prevalence is accompanied by wide confidence bounds, and there was substantial variation in ... informative, especially since rheumatic diseases vary in prevalence by age. An additional source of Editorial Comparing the < /b> prevalence of rheumatic diseases in China wi...

Ngày tải lên: 09/08/2014, 10:22

2 313 0
Báo cáo y học: "Rituximab therapy reduces activated B cells in both the peripheral blood and bone marrow of patients with rheumatoid arthritis: depletion of memory B cells correlates with clinical response" potx

Báo cáo y học: "Rituximab therapy reduces activated B cells in both the peripheral blood and bone marrow of patients with rheumatoid arthritis: depletion of memory B cells correlates with clinical response" potx

... rituximab. Rheumatology (Oxford) 2005, 44:176-182. 31. Tokunaga M, Saito K, Kawabata D, Imura Y,< /b> Fujii T, Nakayamada S, Tsujimura S, Nawata M, Iwata S, Azuma T, Mimori T, Tanaka Y:< /b> Efficacy of ... results, according to the < /b> following equation: Results Clinical characteristics of the < /b> patients and response to rituximab therapy The < /b> clinical and laboratory chara...

Ngày tải lên: 09/08/2014, 14:22

8 376 0
Báo cáo y học: "Mapping the complexity of transcription control in higher eukaryotes" docx

Báo cáo y học: "Mapping the complexity of transcription control in higher eukaryotes" docx

... the < /b> drawbacks of the < /b> two methods [4]. Drosophila embryonic development is particularly amenable to analysis by both in situ hybridization and microarray analysis. Large numbers of approximately ... transcription factor database. Nucleic Acids Res 2010, 38:D443-D447. 6. Ravasi T, Suzuki H, Cannistraci CV, Katayama S, Bajic VB, Tan K, Akalin A, Schmeier S, Kanamori-Katayama...

Ngày tải lên: 09/08/2014, 20:21

4 265 0
Báo cáo y học: "Quantifying the mechanisms of domain gain in animal proteins" doc

Báo cáo y học: "Quantifying the mechanisms of domain gain in animal proteins" doc

... Open Access Quantifying the < /b> mechanisms of domain gain in animal proteins Marija Buljan * , Adam Frankish, Alex Bateman Abstract Background: Protein domains are protein regions that are shared among ... gained domains When a new domain was encoded by a first or last coding exon, the < /b> gain was called as an amino- or car- boxy-terminal gain, respectively. In addition, when a...

Ngày tải lên: 09/08/2014, 20:22

15 385 0
w