Báo cáo khoa học: "nhaled beta-2 agonist salbutamol and acute lung injury: an association with improvement in acute lung injury" doc

... action of EPA and DHA (Eur. J. Biochem. 271) 4473 Modulation of cyclin D1 and early growth response factor-1 gene expression in interleukin-1b-treated rat smooth muscle cells by n-6 and n-3 polyunsaturated ... cyclin D1 gene promoter We studied the mechanism(s) underlying the inhibition of cyclin D1 gene expression by EPA and...

Ngày tải lên: 19/02/2014, 16:20

... position 42 of the vacidin A side chain, Fig. 1) are available for at least five polyene macrolides that belong to a group of polyenes specifically glycosylated by mycosamine, a hexose of the D -series. ... antifungal properties. Polyene macro- lides are of an authentic clinical value for efficient therapies against animals, and human infectious diseases caused by patho...

Ngày tải lên: 21/02/2014, 03:20

... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG 3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG 4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG GGAT 1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC 2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r ... from Triticum kiharae seeds with a unique 10-cysteine motif Tatyana I. Odintsova 1 , Alexander A. Vassilevski 2 , Anna A. Slavokhotova 1 , Alexander K. Musol...

Ngày tải lên: 07/03/2014, 02:20

... Scatchard analysis, which could account for the reduction in catalytic activity. In the current study, we have explored the phenomenon of the induction of cellular refractoriness to the ST peptide in ... [25]. The absence of GC -C desensitization (which is correlated with removal of the 145 kDa form of GC -C from cells) in HEK293-GC -C cells coul...

Ngày tải lên: 08/03/2014, 08:20

... It is known that chemicals which increase intracellular cAMP cause an increase in CFTR protein expression in cell membranes and activation of chloride secretion. The increased CFTR protein has ... kb, respectively. In Caco2 cells the DHS in introns 16 and 17 are of similar intensity but the DHS in intron 18 is less evident ( Fig. 5B). In contrast, the DHS in intr...

Ngày tải lên: 08/03/2014, 10:20

... distal, and the foot (f) at the proximal end of the animal. The arrow points at peroxidase containing cells lying in the ectoderm of the foot. The diaminobenzidine- stained granules are localized ... 2002 Isolation of a putative peroxidase, a target for factors controlling foot-formation in the coelenterate hydra Sabine A. H. Hoffmeister-Ull...

Ngày tải lên: 08/03/2014, 10:20

... B E B B B Domain B B B B B A B A B E B B A B B B B E b – – 31 34 38 43 47 57 62 67 76 81 – 13 17 b 2 10 21 – c 32 35 39 44 48 50 53 58 63 68 72 77 82 25 14 18 22 c 3 6 28 f 36 41 45 49 51 54 59 64 69 73 78 83 26 15 19 24 e 4 7 29 – 40 – – – – – – – – – – – – – – 23 d – – – L-Glyceraldehyde a – – 30 33 37 42 46 56 61...

Ngày tải lên: 16/03/2014, 04:20

... FEBS Effect of oxidative stress and involvement of poly(ADP-ribose) polymerase (PARP) in Dictyostelium discoideum development Jyotika Rajawat*, Iqbal Vohra*, Hina A. Mir, Dhaval Gohel and Rasheedunnisa ... PARP inhibitor, on oxidative stress- induced changes in D. discoideum development. Interestingly, oxidative stress resulted in PARP activation...

Ngày tải lên: 23/03/2014, 07:20

... progress in the study of TRP channels as well as other ion channels in the context of both actin and the microtubule cytoskel- eton. The presence of the microtubule cytoskeleton at the membrane ... involved in the detec- tion and ⁄ or transduction of physical and chemical stimuli. TRPV1 and the cytoskeleton Physical interaction of TRPV1 with...

Ngày tải lên: 30/03/2014, 10:20

... that active taurine uptake in NIH3T3 mouse fibroblasts is linear within the initial 20 min following the addition of 14 C-labelled taurine. Using taurine uptake within the initial 20 min in NaCl medium ... active taurine uptake in NIH3T3 cells. Expression and subcellular localization of TauT The p romoter r egion of the TauT gene in human [1...

Ngày tải lên: 30/03/2014, 15:20

... Linguistics When Conset meets Synset: A Preliminary Survey of an Ontological Lexical Resource based on Chinese Characters Shu-Kai Hsieh Institute of Linguistics Academia Sinica Taipei, Taiwan shukai@gate.sinica.edu.tw Chu-Ren ... conceptual hierarchy and word -based semantic network a character-stored machine-readable lexicon and a top-level character ontolo...

Ngày tải lên: 31/03/2014, 01:20

... between the RC and the cyt bc 1 in the presence of mutated PufX protein The role of the PufX protein in facilitating the ubiquinone/ ubiquinol exchange between the Q B site of the RC and the ubiquinone ... important role in the structure of the core complex [12], we decided to investigate the possible structural role of the N-t...

Ngày tải lên: 31/03/2014, 09:20

... elevated atmospheric CO 2 concentration in live oak (Quercus virginiana Mill.) seedlings in relation to nutrient supply Roberto Tognetti a Jon D. Johnson a a School of Forest ... N concentration in live oak seedlings examined both at a common time and size, to examine the effects of increased [CO 2] on C partitioning...

Ngày tải lên: 08/08/2014, 14:21

... this article as: Presseau et al.: Goal conflict, goal facilitation, and health professionals’ provision of physical activity advice in primary care: An exploratory prospective study. Implementation ... 6:73 http://www.implementationscience.com/content/6/1/73 Page 2 of 9 and above intention and PBC [19], and extend the find- ings to a sample of he...

Ngày tải lên: 10/08/2014, 11:20

... Beta-adrenergic agonists increase alveo- lar fluid clearance in normal lung [13-19] and in several animal models of acute lung injury [20-22] as well as in ex vivo human lungs [19] and in patients with ... (mean and 95% confi- dence interval). Figure 1 Days alive and free of acute lung injury in low dose (<2.2 mg/day) and high dose (≥ 2.2 mg/day) salbutamol...

Ngày tải lên: 12/08/2014, 23:21