Retrovirology Research BioMed Central Open Access Isolation and characterization of a small ppsx

... (ng/ml) C BioMed Central Page 1 of 10 (page number not for citation purposes) Retrovirology Open Access Research Isolation and characterization of a small antiretroviral molecule affecting HIV-1 capsid ... 13 C 2 / 15 N-labeled G-NH 2 by Fmoc pep- Biological and antiviral comparison of α-HGA and some structurally related compoundsFigure 6 Biological and an...

Ngày tải lên: 12/08/2014, 23:20

... 1983, 33:1444-1452. 45. Kamihira S, Sugahara K, Tsuruda K, Minami S, Uemura A, Akamatsu N, Nagai H, Murata K, Hasegawa H, Hirakata Y, Takasaki Y, Tsukasaki K, Yamada Y: Proviral status of HTLV-1 integrated into ... value of tax/value of HPRT. HTLV-1 HBZ mRNA load = value of HBZ/value of HPRT. We used aliquots of the same standard MT-2 cDNA preparation for all assays and the cor...

Ngày tải lên: 12/08/2014, 23:20

... 5'- (6-Fam)AGGACTCATGACCACAGTCCATGCCA(Tamra) CypA forward primer 5'- GGCCGCGTCTCCTTTGA reverse primer 5'- AATCCTTTCTCTCCAGTGCTCAGA Probe 5'- (6-Fam)TGCAGACAAGGTCCCAAAGACAGCAG(Tamra) TRIM5α forward ... (6-Fam)TGCAGACAAGGTCCCAAAGACAGCAG(Tamra) TRIM5α forward primer 5'- TGCCTCTGACACTGACTAAGAAGATG reverse primer 5'- GGGCTAAGGACTCATTCATTGG Probe 5'- (6-Fam)AAGCTT...

Ngày tải lên: 12/08/2014, 23:20

... cells. (A) HeLaT4 (lanes 1 and 3) and HLM-1 (lanes 2 and 4) were Western blotted for Caspase 3 expression and cleavage at Zero (lanes 1 and 2) and 48 (lanes 3 and 4) hours after serum starvation. ... (lanes 1 and 3) and ACH2 (lanes 2 and 4) were Western blotted for Caspase 3 expression and cleavage at Zero (lanes 1 and 2) and 48 (lanes 3 and 4) hours after serum...

Ngày tải lên: 12/08/2014, 23:20

... (Institute of Biomedical Sciences, Academia Sinica). The HeLa cells, NIH3T3 cells, X4 plasmids (fusin-pcDNA1) and X4 anti- bodies were obtained through NIH AIDS Research and Reference Reagent Program. ... cells, X4 plasmids (fusin-pcDNA1), kindly pro- vided by NIH AIDS Research and Reference Reagent Program. This work was supported in part by National Science Foundation and Aca...

Ngày tải lên: 12/08/2014, 23:20

... GTATCT AATAG3'), and JVPvifF2 (5'T GG AAAGG ACCAG CAAAGCT3') and JVPvifR (CTAGGAAAATGTCTAACAGC TT), respectively. We used High Fidelity Polimerase (Plat- inum Taq DNA Polymerase ... Primer and hyb- probe design were specific for hA3G (NM 021822), hu ApoB 3G F2 (CAATAATGACATACAGTGAATTT), hu ApoB 3G R2 (CAGGTCTCTGCCTTCCTTAGA), huApoB3GFL (GACATCCCTGGTGGTCCACA-FL) and hu A...

Ngày tải lên: 12/08/2014, 23:20

... (compare lane 3 to 2) and weakly with Myc-Ago2PAZ9 (compare lane 4 to lanes 3 and 2). Co-localization of HIV-1 mRNA and effectors of RNAi such as Ago2 and RCK/p54 within the P-bodies was also ... Opaluch AM, Caldwell JS, Weitzman MD, Kuhen KL, Bandyopadhyay S, Ideker T, Orth AP, Miraglia LJ, Bushman FD, Young JA, Chanda SK: Global analysis of host-pathogen interactions that regu...

Ngày tải lên: 12/08/2014, 23:20

... lyso- somes. A partial co-localization of Gag and Env appeared with the CD45 plasma membrane protein. Quantification of Gag co-localization with tetraspanins revealed that Gag was mainly distributed ... anti-tetraspanin antibodies was evaluated by FACS analysis. The histograms present the surface staining of untreated cells and cells treated with anti-CD81 (first panel) and ant...

Ngày tải lên: 12/08/2014, 23:20

... Tajima S, Takahashi M, Takeshima SN, Konnai S, Yin SA, Watarai S, Tanaka Y, Onuma M, Okada K, Aida Y: A mutant form of the tax protein of bovine leukemia virus (BLV), with enhanced transactivation ... the replicative pattern between leukemogenic and attenuated strains are only quantitative and that both kinds of viruses trigger parallel temporal fluctuations of viral loads, infe...

Ngày tải lên: 12/08/2014, 23:20

... while A3 A, A3 C, and A3 H contain only one. A3 B, A3 DE, A3 F, and A3 G inhibit HIV-1 replication to different degrees, whereas A3 A and A3 C do not [8,11-16]. Recently, it was shown that A3 H also inhibits ... expressed similar levels of A3 G and A3 F as the parental CEM.NKR (Fig. 3B). Our real-time PCR anal- ysis failed to detect A3 B in any of these cell clones as...

Ngày tải lên: 12/08/2014, 23:20