Retrovirology Research BioMed Central Open Access A novel HIV-1 restriction factor that is potx

... Central Page 1 of 12 (page number not for citation purposes) Retrovirology Open Access Research A novel HIV-1 restriction factor that is biologically distinct from APOBEC3 cytidine deaminases ... through the AIDS Research and Reference Reagent Program. The mouse anti-human A3 F polyclonal anti- body was from Abnova, Taiwan. Other antibodies used included a polycl...

Ngày tải lên: 12/08/2014, 23:20

... lyso- somes. A partial co-localization of Gag and Env appeared with the CD45 plasma membrane protein. Quantification of Gag co-localization with tetraspanins revealed that Gag was mainly distributed ... in plasma membrane invaginations [21]}. It appears that HIV-1 can accumulate Partial inhibition of HIV-1 release using anti-tetraspanin antibodiesFigure 6 Partial inhibition of HIV-...

Ngày tải lên: 12/08/2014, 23:20

... with Sequence Navigator Software. Statistical analysis SPSS statistical software version 11 was used for analyses. The correlation of data was assessed by Spearman's Rho nonparametric method. ... viruses paralleled those of attenuated strains. Altogether these data indicated that a simple quantitative effect distinguishes the circulating proviral loads of leukemogenic from those of a...

Ngày tải lên: 12/08/2014, 23:20

... leukemia/lymphoma and tropical spastic paraparesis/HTLV-associated myelopathy. HTLV-1 encodes a 40 kDa trans-activator, Tax, which plays a crucial role in viral replication and cell transforma- tion ... show that p21 mRNA stability is greatly increased in the presence of Tax. Analyses of newly isolated Tax mutants suggest that the abil- ity of Tax to activate APC/C also correlates w...

Ngày tải lên: 12/08/2014, 23:20

... Indeed, endosomal acidification by a proton translocating ATPase has been shown to be regulated via a Gi-mediated translo- cation pathway [33], which is activated by P2Y receptors upon ATP stimulation. Treatment ... to a rapid hydrolysis by ectonucleases [45], it is believed that in inflamed tissues, the massive ATP release coupled with a down-regulation of the ecto-ATPase CD39...

Ngày tải lên: 13/08/2014, 05:20

... (ng/ml) C BioMed Central Page 1 of 10 (page number not for citation purposes) Retrovirology Open Access Research Isolation and characterization of a small antiretroviral molecule affecting HIV-1 capsid ... incubated in some animal sera. The new compound was identified as α-HGA, which has an unusually simple structure and a novel mechanism of antiviral action. Thus, α-HGA...

Ngày tải lên: 12/08/2014, 23:20

... ERCC1F: GGCGACGTAATTCCCGACTA, ERCC1R: AGTTCTTC- CCCAGGCTCTGC, IER3F: TCTACCCTCGAGTGGTGAG- TATC, IER3R: ACTAAGGGGAGACAAAACAGGAG Results and discussion Sequencing of the HIV-1 TAR derived miRNA cMagi cells were ... mediated by the TAR viral miRNA. TAR miRNA alters apoptotic genes The observation that the HIV-1 TAR miRNA is expressed both in latent and in active infection suggests that...

Ngày tải lên: 12/08/2014, 23:20

... 1983, 33:1444-1452. 45. Kamihira S, Sugahara K, Tsuruda K, Minami S, Uemura A, Akamatsu N, Nagai H, Murata K, Hasegawa H, Hirakata Y, Takasaki Y, Tsukasaki K, Yamada Y: Proviral status of HTLV-1 integrated into the host ... myelopathy/tropical spastic paraparesis. Neurology 1991, 41:457. 41. Izumo S, Goto I, Itoyama Y, Okajima T, Watanabe S, Kuroda Y, Araki S, Mori M, Nagataki S, Matsukura S...

Ngày tải lên: 12/08/2014, 23:20

... CD4-pcDNA3, pEGFP-N1 plasmids and their respective antibodies. Technical assistance from Shu-Fang Cheng, Institute of Chemistry, Academia Sinica is appreciated. We acknowledge the gifts, HeLa cells, ... cells, X4 plasmids (fusin-pcDNA1), kindly pro- vided by NIH AIDS Research and Reference Reagent Program. This work was supported in part by National Science Foundation and Academia Sin...

Ngày tải lên: 12/08/2014, 23:20

... 5'- (6-Fam)AGGACTCATGACCACAGTCCATGCCA(Tamra) CypA forward primer 5'- GGCCGCGTCTCCTTTGA reverse primer 5'- AATCCTTTCTCTCCAGTGCTCAGA Probe 5'- (6-Fam)TGCAGACAAGGTCCCAAAGACAGCAG(Tamra) TRIM5α forward ... (6-Fam)TGCAGACAAGGTCCCAAAGACAGCAG(Tamra) TRIM5α forward primer 5'- TGCCTCTGACACTGACTAAGAAGATG reverse primer 5'- GGGCTAAGGACTCATTCATTGG Probe 5'- (6-Fam)AAGCTT...

Ngày tải lên: 12/08/2014, 23:20