Retrovirology Research BioMed Central Open Access A dose-effect relationship for ppt
Retrovirology Research BioMed Central Open Access A role for CD81 on the late steps of HIV-1 pdf
... lyso- somes. A partial co-localization of Gag and Env appeared with the CD45 plasma membrane protein. Quantification of Gag co-localization with tetraspanins revealed that Gag was mainly distributed ... at least of CD81/CD82/CD63), as a platform for particle assembly with a notable interaction, direct or indirect, between Gag and CD81. CD82 could have been a good candidate for Gag...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access A dose-effect relationship for ppt
... Tajima S, Takahashi M, Takeshima SN, Konnai S, Yin SA, Watarai S, Tanaka Y, Onuma M, Okada K, Aida Y: A mutant form of the tax protein of bovine leukemia virus (BLV), with enhanced transactivation ... and 4 Veterinary and Agrochemical Research Centre, Department of Virology, Uccle, Belgium Email: Carole Pomier - ptepoms@yahoo.fr; Maria Teresa Sanchez Alcaraz - mteresasanchez@hotmail.com;...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access A novel HIV-1 restriction factor that is potx
... while A3 A, A3 C, and A3 H contain only one. A3 B, A3 DE, A3 F, and A3 G inhibit HIV-1 replication to different degrees, whereas A3 A and A3 C do not [8,11-16]. Recently, it was shown that A3 H also inhibits ... calcium phosphate transfection. Antibodies The polyclonal anti-human A3 G antibody was from W. Greene through the AIDS Research and Reference Reagent Program. The mouse a...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access Close phylogenetic relationship between Angolan pdf
... Laguna-Torres A, Cuchi P, Avila MM, Weis- senbacher M, Serra M, Vinoles J, Russi JC, Aguayo N, Galeano AH, Gianella A, Andrade R, Arredondo A, Ramirez E, Acosta ME, Alava A, Montoya O, Guevara A, ... Publica de Angola – Ministério da Saúde, Luanda, Angola and 4 Instituto Nacional de Luta Contra SIDA – Ministério da Saúde, Luanda, Angola Email: Monick L Guimarães - monicklg@ioc.fiocruz...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access Isolation and characterization of a small ppsx
... (ng/ml) C BioMed Central Page 1 of 10 (page number not for citation purposes) Retrovirology Open Access Research Isolation and characterization of a small antiretroviral molecule affecting HIV-1 capsid ... ivan.romero@ki.se; Jan Balzarini - jan.balzarini@rega.kuleuven.ac.be; Anders Vahlne* - anders.vahlne@ki.se * Corresponding author Abstract Background: Formation of an HIV-...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access HIV-1 TAR miRNA protects against apoptosis by ppt
... cells. (A) HeLaT4 (lanes 1 and 3) and HLM-1 (lanes 2 and 4) were Western blotted for Caspase 3 expression and cleavage at Zero (lanes 1 and 2) and 48 (lanes 3 and 4) hours after serum starvation. ... (lanes 1 and 3) and ACH2 (lanes 2 and 4) were Western blotted for Caspase 3 expression and cleavage at Zero (lanes 1 and 2) and 48 (lanes 3 and 4) hours after serum starvation. Densitometr...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access In vivo expression of the HBZ gene of HTLV-1 doc
... myelopathy/tropical spastic paraparesis. Neurology 1991, 41:457. 41. Izumo S, Goto I, Itoyama Y, Okajima T, Watanabe S, Kuroda Y, Araki S, Mori M, Nagataki S, Matsukura S, Akamine T, Nakagawa M, Yamamoto ... were as follows: 5'-CAA ACC GTC AAG CAC AGC TT-3' and 5'-TCT CCA AAC ACG TAG ACT GGG T-3', and the probe was 5'-TTC CCA GGG TTT GGA CAG AGT CTT CT-3'. HBZ mR...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access Recruitment of HIV-1 envelope occurs subsequent ppt
... development for disseminating the results of biomedical research in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical ... cells, X4 plasmids (fusin-pcDNA1), kindly pro- vided by NIH AIDS Research and Reference Reagent Program. This work was supported in part by National Science Foundation and Acad...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access Modulation of HIV-1 infectivity and cyclophilin ppsx
... 5'- (6-Fam)AGGACTCATGACCACAGTCCATGCCA(Tamra) CypA forward primer 5'- GGCCGCGTCTCCTTTGA reverse primer 5'- AATCCTTTCTCTCCAGTGCTCAGA Probe 5'- (6-Fam)TGCAGACAAGGTCCCAAAGACAGCAG(Tamra) TRIM5α forward ... (6-Fam)TGCAGACAAGGTCCCAAAGACAGCAG(Tamra) TRIM5α forward primer 5'- TGCCTCTGACACTGACTAAGAAGATG reverse primer 5'- GGGCTAAGGACTCATTCATTGG Probe 5'- (6-Fam)AAGCTT...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access APOBEC3G mRNA expression in exposed ppt
... Team 2008: A language and environment for statistical computing. Vienna, Austria 2008. 25. Tanaka M, Ueno T, Nakahara T, Sasaki K, Ishimoto A, Sakai H: Downregulation of CD4 is required for maintenance ... AATACTG TATCATCTGCTCC3'), vif initial amplification was per- formed using primers JVPvifF (5'ACAG CAGA GATCCA CT3') and JVPvifR2 (5'AGAATTCTTATTATGGCTTCCA 3'...
Ngày tải lên: 12/08/2014, 23:20