Retrovirology Research BioMed Central Open Access A role for CD81 on the late steps of HIV-1 pdf

... correspond to lyso- somes. A partial co-localization of Gag and Env appeared with the CD45 plasma membrane protein. Quantification of Gag co-localization with tetraspanins revealed that Gag was mainly ... in plasma membrane invaginations [21]}. It appears that HIV-1 can accumulate Partial inhibition of HIV-1 release using anti-tetraspanin antibodiesFigure 6 Partial inhibition o...

Ngày tải lên: 12/08/2014, 23:20

... performed with Sequence Navigator Software. Statistical analysis SPSS statistical software version 11 was used for analyses. The correlation of data was assessed by Spearman's Rho nonparametric ... infected animals only after a prolonged period of latency. From these data, it is possible to propose that infec- tion duration and viral dose, which depends on both RT and clonal...

Ngày tải lên: 12/08/2014, 23:20

... [10]. A3 B, A3 DE, A3 F, and A3 G contain two Zinc-binding motifs, while A3 A, A3 C, and A3 H contain only one. A3 B, A3 DE, A3 F, and A3 G inhibit HIV-1 replication to different degrees, whereas A3 A and A3 C ... A3 G gene contained a R14Q and A3 F contained a Q275E mutation. To test how these mutations affected A3 G and A3 F, these genes were cloned into pcDNA3.1 assa...

Ngày tải lên: 12/08/2014, 23:20

... core formation not only results as a consequence of the proteolytic cleav- age of p55 but also from substantial conformational changes and rearrangements of the p24 [1] which is con- nected to one ... the chemically synthesized α-HGA further confirmed that the antiviral G-NH 2 -metabolite indeed was α-HGA. Conclusion: α-HGA has an unusually simple structure and a novel mecha...

Ngày tải lên: 12/08/2014, 23:20

... (Fig. 1A and 1B). Cloning analysis recovered three clones of the 5' arm of the TAR miRNA (TAR-5p) and 14 clones of the 3' arm (TAR-3p). The 5' end of the TAR-5p miRNA appears to ... mediated by the TAR viral miRNA. TAR miRNA alters apoptotic genes The observation that the HIV-1 TAR miRNA is expressed both in latent and in active infection suggests tha...

Ngày tải lên: 12/08/2014, 23:20

... Murata K, Hayashibara T, Sugahara K, Uemura A, Yamaguchi T, Har- asawa H, Hasegawa H, Tsuruda K, Okazaki T, Koji T, Miyanishi T, Yamada Y, Kamihira S: A novel alternative splicing isoform of human ... Y, Takamori A, Utsunomiya A, Kurimura M, Yamano Y, Hishizawa M, Hasegawa A, Kondo F, Kurihara K, Harashima N, Watanabe T, Okamura J, Masuda T, Kannagi M: Impaired Tax-spe- cific T-cell r...

Ngày tải lên: 12/08/2014, 23:20

... region analyzed by FRAP and the other one used as a fluorescence control. A schematic illustration of an updated HIV-1 Env-mediated fusion modelFigure 7 A schematic illustration of an updated HIV-1 ... [26]. The dynamics of protein complexes at the cell surface are determined by the organization, oligomerization state, and interaction with the membrane lipids and oth...

Ngày tải lên: 12/08/2014, 23:20

... (6-Fam)AGGACTCATGACCACAGTCCATGCCA(Tamra) CypA forward primer 5'- GGCCGCGTCTCCTTTGA reverse primer 5'- AATCCTTTCTCTCCAGTGCTCAGA Probe 5'- (6-Fam)TGCAGACAAGGTCCCAAAGACAGCAG(Tamra) TRIM5α forward primer 5'- TGCCTCTGACACTGACTAAGAAGATG reverse ... TGCCTCTGACACTGACTAAGAAGATG reverse primer 5'- GGGCTAAGGACTCATTCATTGG Probe 5'- (6-Fam)AAGCTTTTCAACAGCCTTTCTATATCATCGTGTGAT...

Ngày tải lên: 12/08/2014, 23:20

... GTATCT AATAG3'), and JVPvifF2 (5'T GG AAAGG ACCAG CAAAGCT3') and JVPvifR (CTAGGAAAATGTCTAACAGC TT), respectively. We used High Fidelity Polimerase (Plat- inum Taq DNA Polymerase ... specific for hA3G (NM 021822), hu ApoB 3G F2 (CAATAATGACATACAGTGAATTT), hu ApoB 3G R2 (CAGGTCTCTGCCTTCCTTAGA), huApoB3GFL (GACATCCCTGGTGGTCCACA-FL) and hu ApoB 3G LC (LC640-GGTGTCCCAGCAGTGCTTAAA-P...

Ngày tải lên: 12/08/2014, 23:20

... (5'- GUGACAUCCUGCCACCUCACUU(dTdT)-3'), GW182 (5'-UAGCGGACCAGACAUUUCU(dTdT)-3'), XRN1 (5'- AGA UGA ACU UAC CGU AGA A( dTdT)-3') and CDK9 (5'-CCAAAGCUUCCCCCUAUAATT(dTdT)-3') ... instructions (Amaxa). siRNA corresponding to DGCR8 (5'-CAUCG- GACAAGAGUGUGAU(dTdT)-3'), Drosha (5'-CGA- GUAGGCUUCGUGACUU(dTdT)-3'), RCK/p54 (5'- GCAGAAAC...

Ngày tải lên: 12/08/2014, 23:20