Báo cáo khoa học: "Early goal-directed therapy after major surgery reduces complications and duration of hospital stay A randomised, controlled trial [ISRCTN38797445]" ppt
Báo cáo khoa học: "Early goal-directed therapy after major surgery reduces complications and duration of hospital stay. A randomised, controlled trial [ISRCTN38797445]" ppt
... AccessAvailable online http://ccforum.com/content/9/6/R687R687Vol 9 No 6ResearchEarly goal-directed therapy after major surgery reduces complications and duration of hospital stay. A randomised, ... data analysis and drafting themanuscript and approved the final version. All authors had fullaccess to data and take responsibility for the integrity of thedata and the accuracy of the analysis.Table ... of notes, radiolog-ical investigations, laboratory data and clinical assessment.Statistical analysisAssuming a two-sided type I error rate of 5% and a power of 80%, we calculated that a sample...
- 7
- 210
- 0
Báo cáo khoa học: "Esophageal Doppler-guided fluid management decreases blood lactate levels in multiple-trauma patients: a randomized controlled trial" pps
... lactate levels in multiple-trauma patients: a randomized controlled trial Ivan Chytra, Richard Pradl, Roman Bosman, Petr Pelnář, Eduard Kasal and Alexandra ŽidkováDepartment of Anesthesia and ... infectious complications, and length of ICU and hospital stays in comparison with standard hemodynamicmanagement in multiple-trauma patients.Materials and methodsThis was a randomized, controlled, ... SOFA dur-ing ICU stay were assessed. MAP and CVP were evaluated atbaseline and at the end of the 12-hour study period. Blood lac-tate levels were assessed at baseline and 12 and 24 hoursafter...
- 9
- 211
- 0
Báo cáo y học: "Intensive care diaries reduce new onset post traumatic stress disorder following critical illness: a randomised, controlled trial" docx
... widespread use and felt to be safe.All tools had been previously translated into Swedish,Norwegian and Italian and checked for accuracy by backtranslation [3]. They were also translated into Danish and ... delusional mem-ories, such as nightmares and hallucinations, that arerecalled afterwards make it difficult for patients to makesense of what has happened to them [6] and has beenshown to be one of ... All patients had their illness severity assessed using anacute physiology and chronic health evaluation(APACHE) II score calculated for the day of admissionto ICU. Length of ICU stay, admission...
- 10
- 487
- 0
Báo cáo khoa học: " Carbon ion therapy for advanced sinonasal malignancies: feasibility and acute toxicity" pdf
... 134:170-177.5. Harbo G, Grau C, Bundgaard T, Overgaard M, Elbrond O, Sogaard H,Overgaard J: Cancer of the nasal cavity and paranasal sinuses. A clinico-pathological study of 227 patients. Acta Oncol ... 0 4,6max (Gy/GyE) median (Gy/GyE)contralaterallensipsilateral mandibularjointcontralateral mandibularjointipsilateral parotid contralateralparotidipsilateraleyecontralateraleyeC12 ... intensity-modulated radiation therapy for cancers of the paranasal sinuses, nasal cavity, and lacrimal glands: technique,early outcome, and toxicity. Head Neck 2008, 30:925-932.19. Madani I, Bonte K, Vkaet...
- 10
- 378
- 0
Báo cáo khoa học: "Parotid gland-recovery after radiotherapy in the head and neck region: 36 months follow-up of a prospective clinical study" pdf
... Dmean of the parotids, and thus on the saliva flow and recovery of parotid gland. Keywords head and neck cancer; irradiation, saliva; hyposalivation; parotid gland sparing; recovery Background ... 24, and at least 36 months after the end of RT. All salivary samples were collected at least one hour after a meal at a standardized time of the day (9:00 am to 11:00 pm). Patients were asked ... only a follow-up period of 12 months. Just one single study by Braam et al. examined the quality of life and salivary flow rates after irradiation of head and neck cancer over a period of 5 years...
- 25
- 342
- 0
Báo cáo khoa học: "Radiation-induced cancer after radiotherapy for non-Hodgkin''''s lymphoma of the head and neck: a retrospective study" ppsx
... designed/conducted analysis and wrote themanuscript. KH and FA assisted in the acquisition and analysis of data. All authors have read and approved thefinal manuscript.Additional materialReferences1. ... cases of secondcancer arose near the previous radiation field: one of laryngeal cancer developing 14 years after RT for NHL of the nasal cavity, and one of esophageal cancer developing16 years after ... increased after RT for early-stage NHL, although a precise relationship between RT and second head and neck malignancies remains unclearbecause of a small number of cases. Anyway, we proposeto regard...
- 7
- 326
- 0
Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf
... CGA TGGATA CAG A- 3¢; reverse, 5¢-AGG ACA GTA GAA TTAGGT CAC T-3¢).Knockdown of Hsp10 5a and Hsp105bThe double-stranded RNA targeting Hsp105 (Dharmacon;5¢-GCA AAU CAC UCA UGC AAA CUU-3¢) was ... Stephanou A, Isenberg DA, Nakajima K & LatchmanDS (1999) Signal transducer and activator of transcrip-tion-1 and heat shock factor-1 interact and activate thetranscription of the Hsp-70 and ... TGGACGCGCGTAACCCGCACAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()298) Sense GCGCTGAAGCGCAGGCGGTCAAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()218) Sense TGTCCCCTCCAGTGAATCCCAGAAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()194)...
- 11
- 584
- 0
Tài liệu Báo cáo khoa học: Cold survival in freeze-intolerant insects The structure and function of b-helical antifreeze proteins pdf
... structure and dynamics of each protein, and present a comparison of s bwAFP and TmAFPwitheachotherandwithproteinsthathaveasimilar fold.Structure of sbwAFP and TmAFPThe structure of sbwAFP has been ... growth.ConclusionAnalysis of the structure and examination of the i ce-bindingbehaviour and point mutants of s bwAFP and TmAFPprovides an explanation for their hyperactivity compared tothe previously characterized ... that of sbwAFP, has a m uch tighter coil path. Anothereffect of the tighter coils is that TmAFP has o ne and a h alfextra coils along the T XT face (Fig. 8A) . This gives TmAFPone and a half additional...
- 12
- 716
- 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... 216GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG 360CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC ... 360CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC 432TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA 504TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576TCCACAGGGGACAACGTCCCCATCGTGCGGGAGGACATGCTGTGTGCTGGGGACAGCGGGAGGAACTTCTGC ... 936cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 1058B -20 AGCAGCCTGGACCTGCCAAG -1ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC...
- 11
- 527
- 0
Báo cáo khoa học nông nghiệp " Reducing pesticide residues, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " docx
... vegetable cultivation, traditional agro-practices, crop diversity of leaf vegetable, tomato, chili, brassica and cucurbits crops, pesticide and plant protection, traditional practices and marketing ... percentage of new varieties (See Table 2 for more detail). The data shows that three years after the implantation of the project, awareness of the farmers about use of new varieties have been ... harvest at least 5-10 days Same 2007, plus compost and synthetic NPK GAP principle Before harvest at least 10 days 2 Leaf vegetables (Chinese mustard, Mustard, Garland, Salad)...
- 13
- 587
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ