Báo cáo khoa học: "Early goal-directed therapy after major surgery reduces complications and duration of hospital stay A randomised, controlled trial [ISRCTN38797445]" ppt
![Báo cáo khoa học: "Early goal-directed therapy after major surgery reduces complications and duration of hospital stay. A randomised, controlled trial [ISRCTN38797445]" ppt](https://media.store123doc.com/images/document/2014_08/15/medium_ddw1407860427.jpg)
Báo cáo khoa học: "Early goal-directed therapy after major surgery reduces complications and duration of hospital stay. A randomised, controlled trial [ISRCTN38797445]" ppt
... Access Available online http://ccforum.com/content/9/6/R687 R687 Vol 9 No 6 Research Early goal-directed therapy after major surgery reduces complications and duration of hospital stay. A randomised, ... data analysis and drafting the manuscript and approved the final version. All authors had full access to data and take responsibility for the integrity of t...
Ngày tải lên: 12/08/2014, 23:20
Báo cáo khoa học: "Esophageal Doppler-guided fluid management decreases blood lactate levels in multiple-trauma patients: a randomized controlled trial" pps
... lactate levels in multiple-trauma patients: a randomized controlled trial Ivan Chytra, Richard Pradl, Roman Bosman, Petr Pelnář, Eduard Kasal and Alexandra Židková Department of Anesthesia and ... infectious complications, and length of ICU and hospital stays in comparison with standard hemodynamic management in multiple-trauma patients. Materials and methods This was...
Ngày tải lên: 13/08/2014, 03:20
Báo cáo y học: "Intensive care diaries reduce new onset post traumatic stress disorder following critical illness: a randomised, controlled trial" docx
... widespread use and felt to be safe. All tools had been previously translated into Swedish, Norwegian and Italian and checked for accuracy by back translation [3]. They were also translated into Danish and ... delusional mem- ories, such as nightmares and hallucinations, that are recalled afterwards make it difficult for patients to make sense of what has happened to them [6] and...
Ngày tải lên: 13/08/2014, 21:21
Báo cáo khoa học: " Carbon ion therapy for advanced sinonasal malignancies: feasibility and acute toxicity" pdf
... 134:170-177. 5. Harbo G, Grau C, Bundgaard T, Overgaard M, Elbrond O, Sogaard H, Overgaard J: Cancer of the nasal cavity and paranasal sinuses. A clinico- pathological study of 227 patients. Acta Oncol ... 0 4,6 max (Gy/GyE) median (Gy/GyE) contralateral lens ipsilateral mandibular joint contralateral mandibular joint ipsilateral parotid contralateral parotid ipsilateral eye contralat...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: "Parotid gland-recovery after radiotherapy in the head and neck region: 36 months follow-up of a prospective clinical study" pdf
... D mean of the parotids, and thus on the saliva flow and recovery of parotid gland. Keywords head and neck cancer; irradiation, saliva; hyposalivation; parotid gland sparing; recovery Background ... 24, and at least 36 months after the end of RT. All salivary samples were collected at least one hour after a meal at a standardized time of the day (9:00 am to 11...
Ngày tải lên: 09/08/2014, 09:21
Báo cáo khoa học: "Radiation-induced cancer after radiotherapy for non-Hodgkin''''s lymphoma of the head and neck: a retrospective study" ppsx
... designed/conducted analysis and wrote the manuscript. KH and FA assisted in the acquisition and analysis of data. All authors have read and approved the final manuscript. Additional material References 1. ... cases of second cancer arose near the previous radiation field: one of laryngeal cancer developing 14 years after RT for NHL of the nasal cavity, and one of esophag...
Ngày tải lên: 09/08/2014, 10:20
Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf
... CGA TGG ATA CAG A- 3¢; reverse, 5¢-AGG ACA GTA GAA TTA GGT CAC T-3¢). Knockdown of Hsp10 5a and Hsp105b The double-stranded RNA targeting Hsp105 (Dharmacon; 5¢-GCA AAU CAC UCA UGC AAA CUU-3¢) was ... Stephanou A, Isenberg DA, Nakajima K & Latchman DS (1999) Signal transducer and activator of transcrip- tion-1 and heat shock factor-1 interact and activate the transcription...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Cold survival in freeze-intolerant insects The structure and function of b-helical antifreeze proteins pdf
... structure and dynamics of each protein, and present a comparison of s bwAFP and TmAFPwitheachotherandwithproteinsthathavea similar fold. Structure of sbwAFP and TmAFP The structure of sbwAFP has been ... growth. Conclusion Analysis of the structure and examination of the i ce-binding behaviour and point mutants of s bwAFP and TmAFP provides an explanation for the...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... 216 GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288 CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG 360 CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC ... 360 CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC 432 TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA 504 TT...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học nông nghiệp " Reducing pesticide residues, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " docx
... vegetable cultivation, traditional agro-practices, crop diversity of leaf vegetable, tomato, chili, brassica and cucurbits crops, pesticide and plant protection, traditional practices and marketing ... percentage of new varieties (See Table 2 for more detail). The data shows that three years after the implantation of the project, awareness of the farmers about use of new...
Ngày tải lên: 21/06/2014, 04:20