Báo cáo khoa học: "Mid-regional pro-adrenomedullin as a prognostic marker in sepsis: an observational study" pot

Báo cáo khoa học: "Mid-regional pro-adrenomedullin as a prognostic marker in sepsis: an observational study" pot

Báo cáo khoa học: "Mid-regional pro-adrenomedullin as a prognostic marker in sepsis: an observational study" pot

... MR- proADM (amino acids 45–92) and has an analytical detection limit of 0.08 nmol/l. Intra-assay imprecision was under 10% over the entire measuring range, and the functional assay sen- sitivity (interassay ... Marutsuka K, Nawa Y, Asada Y, Hara S, Kitamura K, Eto T, Sumiy- oshi A: Adrenomedullin and proadrenomudullin N-terminal 20 peptide (PAMP) are present in human colonic epithelia an...

Ngày tải lên: 12/08/2014, 23:20

9 231 0
Báo cáo khoa học: "Alternative protocol to initiate high-frequency oscillatory ventilation: an experimental study" pot

Báo cáo khoa học: "Alternative protocol to initiate high-frequency oscillatory ventilation: an experimental study" pot

... mg/kg azaperone and 0.02 mg/kg atropine intramuscularly) with 0.01 mg/kg fentanyl (Fentanyl; Janssen Pharmaceuticals, Neuss, Germany) and 5 mg/kg thiopentone (Trapanal; Altana Pharma, Konstanz, ... PaCO 2 at unchanged HFOV settings indicates a decreased alveolar sur- face available for gas exchange. Previous studies in the lavage animal model showed that CO decreased at high mean airway...

Ngày tải lên: 13/08/2014, 03:20

9 291 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

... MINIREVIEW Pharmacologic chaperoning as a strategy to treat Gaucher disease Zhanqian Yu, Anu R. Sawkar and Jeffery W. Kelly Department of Chemistry and The Skaggs Institute for Chemical Biology, ... mechanisms. Proc Natl Acad Sci USA 103, 13813–13818. 29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de- oxynojirimycin as a pharma...

Ngày tải lên: 18/02/2014, 16:20

7 507 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... recovered differentially based on varying stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis ... We have suc- cessfully adapted a phage-display method for quantitating a nities of protein variants (shotgun alanine scanning) to analysis of GB1 stability. Using this me...

Ngày tải lên: 19/02/2014, 12:20

7 502 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting PCR prod- ucts, ... (C J glucose las % 0 and C J l las % 0) as can be inferred from the primary data. However, it is interesting that a slight red...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

... without being changed by the action. Atoms are printed in boldface iff they contradict the goal. This plan can be read as a derivation tree that has one node for each action instance in the plan, and an edge ... gener- ation with TAG grammars and semantic and prag- matic information can be encoded into PDDL. Our encoding is declarative in that it can be used with any correct plann...

Ngày tải lên: 20/02/2014, 12:20

8 339 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... discriminant analysis (LDA).Thisstatistical multivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass variance, and constructs ... Many parameters can be adjusted for increasing the efficiency of the algorithm. The data were analysed with a window of five wavenumbers, assuming that adjacent wavenumbers are highly c...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

... 5204–5210. 28. Sharath, A. N., Weinhold, E. & Bhagwat, A. S. (2000) Reviving a dead enzyme: cytosine deaminations promoted by an inactive DNA methyltransferase and S-adenosylmethyonine analogue. Biochemistry ... of 2-pyrimidinone containing DNA as a MTase inhibitor. 2-pyrmidinone incorporation in DNA sequences may also serve as a specific probe for studying discrimination c...

Ngày tải lên: 07/03/2014, 15:20

9 437 0
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

... polyclonal ASA antiserum. Precipitated ASA was quantified after SDS ⁄ PAGE with a bio-imaging analyser (Fujifilm). Columns show mean, minimal and maximal deviation of arbitrary units of two independent ... Sci USA 80, 6066–6070. 13 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Acceler- ated transport and maturation of lysosomal alpha-galac- tosidase A in Fabry lymphoblasts by an enzyme...

Ngày tải lên: 07/03/2014, 17:20

10 505 0
Báo cáo khoa học: "GAMR VIEWED AS A FUNCTIONING PART OF A COGNITIVES SERM A YTM" pot

Báo cáo khoa học: "GAMR VIEWED AS A FUNCTIONING PART OF A COGNITIVES SERM A YTM" pot

... Using spreading activation, the syntactic category aspect of each meaning in turn activates the category's meaning in the grammar space representation. Part of the grammatical meaning ... grammar, and pragmatic or local context, receive support as separately definable knowledge within studies of aphasia. There is a vast literature concerning what aspects of language are...

Ngày tải lên: 08/03/2014, 18:20

9 379 0
Từ khóa:
w