Báo cáo khoa học: "Quantifying bedside-derived imaging of microcirculatory abnormalities in septic patients: a prospective validation study" docx
... 6 Research Quantifying bedside-derived imaging of microcirculatory abnormalities in septic patients: a prospective validation study E Christiaan Boerma 1,2 , Keshen R Mathura 1 , Peter HJ van der ... 99 Total 224 Table 4 Statistical data for semi-quantitative flow scoring in the sublingual region and in combined stoma sites Reliability Agreement Chance Kappa a κ w...
Ngày tải lên: 12/08/2014, 22:22
... chest radiograph. Figure 7 Axial computed tomography (CT) image in mediastinal soft tissue window-level setting shows the characteristic appearance of a fat-containing tumor with density values of approximately -50 ... units), the diagnosis of a fat-containing tumor of the pleura can be made. However, making the differentiation between well differentiated, malignant liposarcomas...
Ngày tải lên: 11/08/2014, 02:22
... quantitative and qualitative analysis. On closer examination, the shikimate experiment shows only that at least a certain fraction of the xanthone derivative was obtained from a shikimate inter- mediate ... (7)wasreportedtobe incorporated into xanthones from Gentiana lutea, albeit with low incorporation rates [10], and label from cinnamic acid and benzoic acid was diverted to the xantho...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo hóa học: " Quantifying the quality of hand movement in stroke patients through three-dimensional curvature" potx
... deficits, a reduction in motor command [40], or an increase in motor com- mand noise, can lead to an increase in curvature. Any inappropriate increase in mechanical impairments due to spasticity or an ... was extracted. The median -log()atallextractedtime points was computed as a representative of that trajec- tory, and designated MedianLC. Jerk and MedianLJ (median of log o...
Ngày tải lên: 19/06/2014, 08:20
báo cáo khoa học: " Health system determinants of infant, child and maternal mortality: A cross-sectional study of UN member countries" doc
... sustainable access to water and sanitation, health financing, and transparent governance are important pathways to reducing mortality rates. Health financing is not currently listed within the ... education as an important variable related to infant mortality, we did not include this as an explanatory variable because the data was not adequately populated [11]. In place, we used the in...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo toán học: "The maximum number of perfect matchings in graphs with a given degree sequence" docx
... rows and columns of the adjacency matrix of G it is a block diagonal matrix in which every block is an all-1 square matrix, and as our graph G has no loops, this means that it is a union of complete ... a square all-1 matrix. Proof of Theorem 1.1: The square of the number of perfect matchings of G counts ordered pairs of such matchings. We claim that this is the number...
Ngày tải lên: 07/08/2014, 15:22
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG CTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: ... CACGAG-3¢;TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5 ¢-CAGACCC ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: T...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... H, Baba N, Miyahara M, Miyam- oto K, Yasuda M & Inamori Y (2002) Identification and characterization of the gene cluster involved in chitin degradation in a marine bacterium, Alteromonas sp. ... a rapid phase, regardless of the presence of LlCBP3 3A. In the presence of LlCBP3 3A, the fast initial phase was maintained longer than in the absence of LlCBP3 3A, indicating...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... Src and JAK tyrosine kinases participates in growth regulation of human breast carcinoma cells. Oncogene 20, 2499–2513. 9 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, ... (2004) The interaction of specific peptide aptamers with the DNA binding domain and the dimerization domain of the transcrip- tion factor Stat3 inhibits transactivation and induces apoptosis...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt
... C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR ... T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A...
Ngày tải lên: 19/02/2014, 07:20