Báo cáo khoa học: "Quantifying bedside-derived imaging of microcirculatory abnormalities in septic patients: a prospective validation study" docx

... 6ResearchQuantifying bedside-derived imaging of microcirculatory abnormalities in septic patients: a prospective validation studyE Christiaan Boerma1,2, Keshen R Mathura1, Peter HJ van der ... 99Total 224Table 4Statistical data for semi-quantitative flow scoring in the sublingual region and in combined stoma sitesReliability Agreement Chance Kappa a κwSublingualInterrater 0.90 ... microcirculation in vascular beds of the sublingualand stoma region were obtained, processed and analysed in a standardised way. We validated intra-observer and inter-observer reproducibility with kappa...

báo cáo khoa học: " Computed tomography imaging of subpleural lipoma in two men: two case reports" potx

... chestradiograph.Figure 7 Axial computed tomography (CT) image in mediastinalsoft tissue window-level setting shows the characteristicappearance of a fat-containing tumor with density values of approximately -50 ... units),the diagnosis of a fat-containing tumor of the pleura canbe made. However, making the differentiation betweenwell differentiated, malignant liposarcomas and benignlipomas may be challenging ... CT images. The typicalcharacteristics of a malignant tumor include invasivegrowth, inhomogeneous enhancement after intravenouscontrast medium application, poor delineation of thelesion and...

Báo cáo khoa học: Phenylalanine-independent biosynthesis of 1,3,5,8-tetrahydroxyxanthone A retrobiosynthetic NMR study with root cultures of Swertia chirata docx

... quantitative andqualitative analysis. On closer examination, the shikimateexperiment shows only that at least a certain fraction of thexanthone derivative was obtained from a shikimate inter-mediate ... (7)wasreportedtobeincorporated into xanthones from Gentiana lutea, albeit withlow incorporation rates [10], and label from cinnamic acidand benzoic acid was diverted to the xanthone, mangostin, in Garcinia ... the13C-NMRspectra was integrated separately. The relative fractions of each respective satellite pair in the total13C-NMR signalintegral of a given carbon atom were then calculated(%13C13C in Table...

Báo cáo hóa học: " Quantifying the quality of hand movement in stroke patients through three-dimensional curvature" potx

... deficits, a reduction in motor command [40], or an increase in motor com-mand noise, can lead to an increase in curvature. Anyinappropriate increase in mechanical impairments dueto spasticity or an ... wasextracted. The median -log()atallextractedtimepoints was computed as a representative of that trajec-tory, and designated MedianLC.Jerk and MedianLJ (median of log of jerk)Jerk a t each ... LED marker attached to the glass,infrared light was emitted, which was detected by threecameras.AcknowledgementsWe thank Drs Maiko Osada, Daisuke Matsuura, Mari Ito, Kaoru Honaga,Takamichi...

báo cáo khoa học: " Health system determinants of infant, child and maternal mortality: A cross-sectional study of UN member countries" doc

... sustainable access to water and sanitation, health financing, and transparent governance are important pathways to reducing mortality rates. Health financing is not currently listed within the ... education as an important variable related to infant mortality, we did not include this as an explanatory variable because the data was not adequately populated [11]. In place, we used the indicator ... and Roll Back Malaria Campaigns, all typically considered a vertical approach to health. These disease-focused initiatives are intensive, may avoid the bureaucracies and inefficiencies of a...

Báo cáo toán học: "The maximum number of perfect matchings in graphs with a given degree sequence" docx

... rows andcolumns of the adjacency matrix of G it is a block diagonal matrix in which every blockis an all-1 square matrix, and as our graph G has no loops, this means that it is a union of complete ... a square all-1 matrix.Proof of Theorem 1.1: The square of the number of perfect matchings of G countsordered pairs of such matchings. We claim that this is the number of spanning 2-regularsubgraphs ... cycles) of H with more than 2 vertices. Indeed, every union of a pair of perfect matchings M1, M2is a 2-regular spanning subgraph H as above, and forevery cycle of length exceeding 2 in H there...

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... and ACCAGCTGGGCCAACATTTC; collagen III:TGGACAGATGCTGGTGCTGAG and GAAGGCCAGCTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGGAGCCATTGTCACACAC; and glyceraldehyde-3-phosphatedehydrogenase: ... CACGAG-3¢;TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTACCACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5 ¢-CAGACCCACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAACCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTTCAA and ACCAGCTGGGCCAACATTTC; ... ChineseAcademy of Sciences, Beijing, China) was added to eachwell to a ﬁnal concentration of 1 lCiÆmL)1during the last6 h of incubation. Stimulation was terminated by rinsingthe cardiac...

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... H, Baba N, Miyahara M, Miyam-oto K, Yasuda M & Inamori Y (2002) Identiﬁcationand characterization of the gene cluster involved in chitin degradation in a marine bacterium, Alteromonassp. ... a rapid phase, regardless of the presence of LlCBP3 3A. In the presence of LlCBP3 3A, the fastinitial phase was maintained longer than in the absence of LlCBP3 3A, indicating that LlCBP3 3A acts ... CBP21 and CHB1.Degradation of a- and b-chitinThe degradation rates of a- and b-chitin were assayedwith LlChi1 8A in the presence or absence of LlCBP3 3A. As both chitin variants, and especially a- chitin,...

Tài liệu Báo cáo khoa học: Efﬁcient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

... Src and JAK tyrosine kinases participates in growth regulation of human breast carcinoma cells.Oncogene 20, 2499–2513.9 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M,Nakajima T, Kawashima T, ... (2004) The interaction of speciﬁc peptide aptamers with the DNA bindingdomain and the dimerization domain of the transcrip-tion factor Stat3 inhibits transactivation and inducesapoptosis in tumor ... apoptosisand cell cycle arrest of colon carcinoma cells. Am JPathol 167, 969–980.27 Kunnumakkara AB, Anand P & Aggarwal BB (2008)Curcumin inhibits proliferation, invasion, angiogenesisand metastasis...

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... C)AATTTC-3¢ PsCBL (degenerate forward)45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse)55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward)65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR ... T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward)25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse)35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL ... AAR01663) and AtCBL3(AAM91280). The calcium binding domains (EF1–4) and calcineurin A binding domain are shown in the box. The dot in the EF1 box repre-sents the modiﬁed amino acids alanine (A) as...

Xem thêm