Báo cáo khoa học: "Efficiency of 7 2% hypertonic saline hydroxyethyl starch 200/0 5 versus mannitol 15% in the treatment of increased intracranial pressure in neurosurgical patients – a randomized clinical trial [ISRCTN62699180]" pptx
![Báo cáo khoa học: "Efficiency of 7.2% hypertonic saline hydroxyethyl starch 200/0.5 versus mannitol 15% in the treatment of increased intracranial pressure in neurosurgical patients – a randomized clinical trial [ISRCTN62699180]" pptx](https://media.store123doc.com/images/document/2014_08/14/medium_kZKnW9NZqy.jpg)
Báo cáo khoa học: "Efficiency of 7.2% hypertonic saline hydroxyethyl starch 200/0.5 versus mannitol 15% in the treatment of increased intracranial pressure in neurosurgical patients – a randomized clinical trial [ISRCTN62699180]" pptx
... mmHg 7. 2% NaCl/HES 200/0. 5 60 [39 78 ] 72 ** [54 – 85] 72 ** [55 –8 9] 75 **, # [6 2–8 6] 73 **, # [58 –8 8] Mannitol 15% 61 [ 47 71 ] 70 ** [50 79 ] 70 ** [56 –9 2] 72 ** [6 0–9 3] 69** [56 –8 9] *p < 0. 05, **p ... saline hydroxyethyl starch 200/0. 5 (7. 2% NaCl/HES 200/0. 5) in comparison with 15% mannitol in the treatment...
Ngày tải lên: 12/08/2014, 22:22
Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt
... contains a deletion of the majority of domain Ia (D 1– 250 ) and a portion of domain Ib (D3 65 380) from native PE. Several RITs incorporat- ing a 38 kDa fragment of PE are in preclinical evalua- tion ... PE38) has undergone several early-phase clinical trials for the treatment of B cell malignancies [ 35 37] . These trials have validated the use of CD22 as a...
Ngày tải lên: 22/03/2014, 15:21
Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx
... a- Fuc3NAc (1fi2) a- Rha) B A, B– A B A A, B A A, B A A, B A A B A A A, B A A A, B A A A, B A A A, B A A A, B– A A A, B A A A, B A A A Several of these combinations were found by means of an in- depth ... were A A B A A B A A, A A B A A B A A, A A B A AvB A A and A A B– A A B A A (B: b-Rhap ,A: a-Rhap, A: a- Fucp3NAc(1fi2 )a- Rhap). The phi and psi angles are defined...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx
... 5 -TCCCCAGATGATGCCTTTGTT-3¢; ATP synthase subunit b :5 -CCTTCTGCTGTGGGCTATCA-3¢ and 5 - TCAAGTCATCAGCAGGCACA-3¢; ND5: 5 -TAACCCC ACCCTACTAAACC-3¢ and 5 -GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5 -CAACTTCATCCACGTTCA CC-3¢ ... were as fol- lows: ERRa :5 -AAGACAGCAGCCCCAGTGAA-3¢ and 5 -ACACCCAGCACCAGCACCT-3¢; PRC: 5 -CACTGG TTGACCCTGTTCCT-3¢ and 5 -GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c :5 -CCAGT...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: "Letter to Editor: Carpal tunnel syndrome due to an atypical deep soft tissue leiomyoma: The risk of misdiagnosis and mismanagement" ppsx
... 20 07, 118:1 177 -1 178 . Schwannoma of median nerve at palm: A case of Schwan-noma: the picture shows an increased cross sectional area of median nerve at palmFigure 1 Schwannoma of median nerve at ... we think that, being US an inexpensive and easily available method which also provides a dynamic exami- nation, it may be the first-line approach to the nerve. The cost-b...
Ngày tải lên: 09/08/2014, 07:21
Báo cáo khoa học: Etoposide upregulates Bax-enhancing tumour necrosis factor-related apoptosis inducing ligand-mediated apoptosis in the human hepatocellular carcinoma cell line QGY-7703 pdf
... caspases, such as caspase-3 and -7 [55 ]. The death ligands and the chemotherapeutic agents are two distinct classes of signals used to induce apoptosis and activate the caspase cascade. Caspase-8 ... 5 -CGGA TCCTTAGGACATGGCAGAG-3¢;DcR2forward, 5 -CGGAATTCCGCGGAAGAAATTCATTTCT-3¢; DcR2 reverse, 5 -CGGGATCCTCACAGGCAGGACG TAGCAG-3¢; Bax forward, 5 -GCGAATTCCATGG ACGGGTCCGGGGAG-3¢; B...
Ngày tải lên: 23/03/2014, 17:22
Báo cáo khoa học: "An artificial regeneration system for establishing northern red oak on dry-mesic sites in the Lake States, USA" pptx
... according to Kotar et al (1988). The average stand diameter was 19 cm and the ba- sal area averaged 27. 5 m2 /ha. The site index for northern red oak is 18.6 m (at age ... gaining in popularity as a re- sult of research. The study included 48 bare- root, 12 containerized and 35 root-graded seed- lings (ie 5 grades x 7 seedli...
Ngày tải lên: 08/08/2014, 23:22
Báo cáo y học: "Interactions among type I and type II interferon, tumor necrosis factor, and -estradiol in the regulation of immune response-related gene expressions in systemic lupus erythematosus" potx
... analysis. CA performed labeling and scan- ning of the microarrays. YA assisted with data analysis. NY-H assisted with data analysis. KM assisted in microarray data acquirement. NN designed the study, ... MA, USA) and the signal values were calcu- lated using the DNASIS Array (Hitachi Software Engineering, Tokyo, Japan) according to the manufacturer's instructions. The int...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: " Interactions among type I and type II interferon, tumor necrosis factor, and -estradiol in the regulation of immune response-related gene expressions in systemic lupus erythematosus" pptx
... analysis. CA performed labeling and scan- ning of the microarrays. YA assisted with data analysis. NY-H assisted with data analysis. KM assisted in microarray data acquirement. NN designed the study, ... motif) receptor 7, and acute phase proteins such as serum amyloid A 1 and apelin. These data, together with a previous report of increased TNF levels in the serum of S...
Ngày tải lên: 09/08/2014, 13:22
báo cáo khoa học: " A strong constitutive ethylene-response phenotype conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1 and ERS1" ppsx
... [20]. A line was identified that contained a T-DNA insertion within the first exon of ERS1 (Fig. 1A) . Sequence at the T-DNA junction with ERS1 was ATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtc- cggg), ... T-DNA insertion, and ETR1-3'F (5& apos; CATACCGAAAGTTCCAGCCATTC 3') and ETR1-3'R (5& apos; CAAGCATCCATAACTCGATCCAAATTC 3') for amplifica- tion of a prod...
Ngày tải lên: 12/08/2014, 05:20