Báo cáo khoa học: "Inspiratory oscillatory flow with a portable ventilator: a bench study" pps

... Haas CF, Wahl WL: Intrahospital transport of the adult mechanically ventilated patient. Respir Care Clin North Am 2002, 8:1-35. 5. Uusaro A, Parviainen I, Takala J, Ruokonen E: Safe long-distance interhospital ... conclusion that the phenomenon is potentially dangerous and harmful. There is an airway pressure overshoot, the mean airway pressure is increased and the peak airway pressure may r...

Ngày tải lên: 12/08/2014, 22:21

... negation (NEG) and question words (QW) are handled as separate categories. Adjec- tival particle (A) , KER (KER), SE (SE) and WALA (WALA) are ambiguous entities which are annotated with separate ... of a word having a par- ticular tag is called lexical probability. Both, the transitional and the lexical probabilities are used to select the tag of a particular word. As a standa...

Ngày tải lên: 08/03/2014, 21:20

... cytokines and are capable of activating a cascade of intracellular pathways that regulate cell growth/differentiation and also produce antiviral and immunological responses [4,15]. Particularly, the antitu- mor ... Oregon, UT). Statistical analysis All data are presented as the mean ± SD (standard devia- tion), and statistical differences between groups were assessed with the unpaired Stu...

Ngày tải lên: 10/08/2014, 22:20

... adenocarcinoma with signet-ring cells: A case report Fernando Bazan 1* , Juan Sanchez 1 , Guadalupe Aguilar 1 , Aleksandar Radosevic 1 , Marcos Busto 1 , Flavio Zuccarino 1 , Lara Pijuan 2 and Noelia Risueño 1 Abstract Introduction: ... of the patient. * Correspondence: LBazan@parcdesalutmar.cat 1 Department of Radiology, Parc de Salut Mar Hospital, Barcelona, Catalu a, Spain Full list o...

Ngày tải lên: 10/08/2014, 23:20

... heart failure. Case presentation A 24 year old nulliparous Hi spanic woman with no past medical history presented at 40 weeks of gestation in active labor. Her antenatal course had been uncompli- cated and ... pregnancy there are normal physiologic changes in the human car- diovascular system. These include an increase in the blood volume, an increa se in hea rt rate, a decrea se in sys...

Ngày tải lên: 11/08/2014, 02:21

... Michio Isoda, Martin Kay, Hideo Miyoshi, Hi- roshi Nakagawa, Hideyuki Nakashima, Livia Polanyi, and Yoshihiro Ueda. We also thank John Etchemendy, David Israel, Ray Perrault, and anonymous ... translation must sometimes be a matter of approximating the meaning of a source language text rather than finding an exact counterpart in the target language. We propose a translation frame...

Ngày tải lên: 20/02/2014, 21:20

... 8.5, the approach to steady-state consisted of a simple exponential acceleration. The damped oscillations were analyzed by both a numerical approximation and simulation based on a theoretical model. ... k 2 is the rate constant for acylation, and k 3 istherateconstant for deacylation]. P 1 is the indole product and P 2 the carboxylic acid product (acetate). With NMIA as substrate, acy...

Ngày tải lên: 07/03/2014, 14:20

... 5¢-GAATTCTAATAC GACTCAGAATGAGTCTGGGCCTCTTTTTAAGAAC-3¢; 8–17 variant DNAzyme, 5¢-AATACTCCGAGCCGGTCG GGCCTC-3¢; DRc DNAzyme, 5¢-GAATTCTAATACTCC GAGCCGGTCGGGCCTCTTTTTAAGAAC-3¢) were pre- pared by automated ... including the ease of RNA substrate and DNAzyme synthesis without any chemical modification, and convenient use of RNase A as a common bioreagent, an attractive property for DNAzymes th...

Ngày tải lên: 16/02/2014, 15:20

... Ichimiya S, Nakagawara A, Sakuma Y, Kimura S, Ikeda T, Satoh M, Takahashi N, Sato N & Mori M (2000) p73: structure and function. Pathol Int 50, 589–593. 23 Levrero M, De Laurenzi V, Costanzo A, ... cisplatin-damaged DNA: a clue to anticancer activity of cisplatin. FASEB J 12, 791–799. 30 Kasparkova J & Brabec V (1995) Recognition of DNA interstrand cross-links of cis-diamminedichl...

Ngày tải lên: 19/02/2014, 05:20

... (CAGGACAGCCTGCGCAACGAG), RVR (CAG GACAGGGTGCGCAACGAG), SVR (CAGGACAG CGTGCGCAACGAG) and SLC (AGGGTATCCCTC TGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI ... in all lanes loaded with bacterial protein. The CYP 6A2 variants have the same apparent molecularmassasCYP 6A2 fromD. melanogaster microsomes. The apoenzyme production varied among the variants. N...

Ngày tải lên: 19/02/2014, 12:20