0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "High-frequency oscillatory ventilation in children: a single-center experience of 53 cases" pot

Báo cáo khoa học:

Báo cáo khoa học: " Intrapulmonary percussive ventilation in acute exacerbations of COPD patients with mild respiratory acidosis: a randomized controlled trial [ISRCTN17802078" ppt

... constant in these patients andare responsible for an increase in airway resistance and airtrapping [5]. This air trapping and increased airway resistanceresult in hyperinflation and intrinsic ... cough-ing. Airway plugging causes impaired ventilation, resulting in lower ventilation- to-perfusion ratios. Increased airway resist-ance to airflow and air trapping result in hyperinflation of ... exchange were comparableto the stable state.Statistical analysisThe primary outcome variable was the avoidance of a worsen-ing of the acute exacerbation leading to decompensation,defined...
  • 8
  • 320
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Injurious mechanical ventilation in the normal lung causes a progressive pathologic change in dynamic alveolar mechanics" potx

... microscopicfields were analyzed in each animal at each timepoint. A mean of 38 alveoli (range 8–65) per timepoint per animal was ana-lyzed. The large range was due to alveolar collapse (atelecta-sis) in the ... breaths.Image analysis of alveoliWe analyzed the alveolar mechanics by replaying the videoframe-by-frame and capturing still images of individual alveoliat peak inspiration (I) and end expiration ... Individual alveoli were outlined and the area at peak inspiration (I) and end expiration (E) was measured using image analy-sis software. Alveolar stability was assessed by the percentage change in...
  • 9
  • 277
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113 653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... Purification and characterization of a transmembrane domain-deleted form of lecithinretinol acyltransferase. Biochemistry 42, 6090–6098.45 Muniz A, Villazana-Espinoza ET, Thackeray B & TsinAT ... CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113 653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... X-linked agammaglobulin-emia. A clinical and molecular analysis. Medicine(Baltimore) 75, 287–299.27 Plebani A, Soresina A, Rondelli R, Amato GM, AzzariC, Cardinale F, Cazzola G, Consolini ... Hussain1,2,*, Liang Yu1,3,*, Rani Faryal1,2, Dara K. Mohammad1, Abdalla J. Mohamed1,4and C. I. Edvard Smith11 Clinical Research Center, Department of Laboratory Medicine, Karolinska Institutet, ... T-cell kinase (ITK) could in uence the infectivity of HIVand also have anti -in ammatory activity. Since 2006, several patients carry-ing a fusion protein, originating from a translocation joining...
  • 10
  • 926
  • 0
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... compilation ª 2006 FEBSand alkali extraction might not always be a reliableindicator of whether a protein is integral in the outermembrane [17,20–22].As a distinct means to separate integral and ... Osanai K, Takahashi K, Nakamura K, Takahashi M,Ishigaki M, Sakuma T, Toga H, Suzuki T & VoelkerDR (2005) Expression and characterization of Rab38, a new member of the Rab small G protein ... yeast mitochondrial outer mem-brane in yeast is integral in the membrane and most of the integral outer membrane proteins behave as if theyhave a- helical transmembrane segments, partitioninginto...
  • 9
  • 554
  • 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... ON357, 5¢-TGAAACATCACCAACTAAATCTCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGGAAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAGCAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢;and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢.Direct ... inducethe activation of intracellular cascades such as themitogen-activated protein (MAP) kinase – also calledextracellular signal-regulated kinase (ERK) – cascade.The serine ⁄ threonine kinases ... mutating the amino acid to alanine, nor poten-tially mimicking it by mutation to aspartic acid orglutamic acid, in uenced the ability of recombinantHA-Ras-GRF1 to induce phosphorylation of ERK1...
  • 13
  • 730
  • 0
Báo cáo khoa học: Adipophilin protein expression in muscle – a possible protective role against insulin resistance pot

Báo cáo khoa học: Adipophilin protein expression in muscle – a possible protective role against insulin resistance pot

... results obtained in thepresent study indicate that adipophilin protein expression in muscle isinvolved in maintaining insulin sensitivity.AbbreviationsAdfp, adipophilin; CLB, classical lysis ... impairment of insulin signaling than cells treated withpalmitic acid. Additionally, we show that peroxisome proliferator-activatedreceptor (PPAR )a, PPARb ⁄ d and PPARc agonists all increase ... total Akt and phosphorylated Akt at serineresidue 473 [pAkt(Ser473)]. The ratio between pAktand total Akt was calculated as an indicator of insulinsensitivity. Figure 3C shows that the ratio...
  • 13
  • 373
  • 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

... theN-terminal domain, the comparable overall trypto-phan exposure in the mutants compared with thewild-type protein indicates that the structure of theN-terminal domain is maintained, at least in ... at a molarratio of 0.5 : 1.0 Hsp25 : insulin (Fig. 7), with allmutants showing comparable suppression of insulinprecipitation at this ratio. All of the glutamic acidresidue mutants, in particular ... actingas a solubilizer [22]. The oligomeric sizes of aA-crystal-lin, bacterial Hsp16.3 and bacterial HspH are affectedby C-terminal extension removal [23,24], indicating thatthe C-terminal...
  • 14
  • 417
  • 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... out,making use of the whole receptor intracellular part amputa-ted of its highly variable C-terminal domain after theterminal conserved arginine of the cytoplasmic serine ⁄threonine kinase domain. ... Crassostrea gigas A. Herpin et al.Daf-1 C. elegansCrassostrea gigas C2 domainALK-6 E. fluviatilis C2 domainCrassostrea gigas C1 domainWit D. melanogasterPunt D. melanogasterActR-2b H. sapiensActR-2b ... Renucci A, Lemarchandel V & Rosa F (1996) An acti-vated form of type I serine ⁄ threonine kinase receptorTARAM -A reveals a specific signalling pathwayinvolved in fish head organiser formation....
  • 17
  • 508
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " The Signal System in Interlingua — A Factor in Mechanical Translation" potx

... Russian balalaika and a resonant Spanish guitar, and so forth make fascinating material for descriptive and analytical studies in some branch of meta- linguistics. But no fundamental research ... view of translation and of mechanical translation in par- ticular is not that the signal system of departure language and target language be complete in any absolute sense of the term but rather ... resynthesis in the translator's mind, the translator himself must not be aware of them any more than a healthy diner is aware of what happens to a slice of steak on its way to generating a new...
  • 6
  • 338
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ