Báo cáo khoa học: "High-frequency oscillatory ventilation in children: a single-center experience of 53 cases" pot
Báo cáo khoa học: " Intrapulmonary percussive ventilation in acute exacerbations of COPD patients with mild respiratory acidosis: a randomized controlled trial [ISRCTN17802078" ppt
... constant in these patients and are responsible for an increase in airway resistance and air trapping [5]. This air trapping and increased airway resistance result in hyperinflation and intrinsic ... cough- ing. Airway plugging causes impaired ventilation, resulting in lower ventilation- to-perfusion ratios. Increased airway resist- ance to airflow and air trapping result in hyperi...
Ngày tải lên: 12/08/2014, 22:22
Báo cáo khoa học: "Injurious mechanical ventilation in the normal lung causes a progressive pathologic change in dynamic alveolar mechanics" potx
... microscopic fields were analyzed in each animal at each timepoint. A mean of 38 alveoli (range 8–65) per timepoint per animal was ana- lyzed. The large range was due to alveolar collapse (atelecta- sis) in the ... breaths. Image analysis of alveoli We analyzed the alveolar mechanics by replaying the video frame-by-frame and capturing still images of individual alveoli at peak insp...
Ngày tải lên: 13/08/2014, 03:21
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113 653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... Purification and characterization of a transmembrane domain-deleted form of lecithin retinol acyltransferase. Biochemistry 42, 6090–6098. 45 Muniz A,...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx
... X-linked agammaglobulin- emia. A clinical and molecular analysis. Medicine (Baltimore) 75, 287–299. 27 Plebani A, Soresina A, Rondelli R, Amato GM, Azzari C, Cardinale F, Cazzola G, Consolini ... Hussain 1,2, *, Liang Yu 1,3, *, Rani Faryal 1,2 , Dara K. Mohammad 1 , Abdalla J. Mohamed 1,4 and C. I. Edvard Smith 1 1 Clinical Research Center, Department of Laboratory Medicine, Karolinska...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx
... compilation ª 2006 FEBS and alkali extraction might not always be a reliable indicator of whether a protein is integral in the outer membrane [17,20–22]. As a distinct means to separate integral and ... Osanai K, Takahashi K, Nakamura K, Takahashi M, Ishigaki M, Sakuma T, Toga H, Suzuki T & Voelker DR (2005) Expression and characterization of Rab38, a new member of the Rab...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx
... ON357, 5¢-TGAAACATCACCAACTAAATC TCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGG AAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAG CAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢; and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢. Direct ... induce the activation of intracellular cascades such as the mitogen-activated protein (MAP) kinase – also called extracellular signal-regulated kinase (ERK) – cascade. The serine ⁄ threoni...
Ngày tải lên: 19/02/2014, 18:20
Báo cáo khoa học: Adipophilin protein expression in muscle – a possible protective role against insulin resistance pot
... results obtained in the present study indicate that adipophilin protein expression in muscle is involved in maintaining insulin sensitivity. Abbreviations Adfp, adipophilin; CLB, classical lysis ... impairment of insulin signaling than cells treated with palmitic acid. Additionally, we show that peroxisome proliferator-activated receptor (PPAR )a, PPARb ⁄ d and PPARc agonists all incr...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx
... the N-terminal domain, the comparable overall trypto- phan exposure in the mutants compared with the wild-type protein indicates that the structure of the N-terminal domain is maintained, at least in ... at a molar ratio of 0.5 : 1.0 Hsp25 : insulin (Fig. 7), with all mutants showing comparable suppression of insulin precipitation at this ratio. All of the glutamic acid residue...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... out, making use of the whole receptor intracellular part amputa- ted of its highly variable C-terminal domain after the terminal conserved arginine of the cytoplasmic serine ⁄ threonine kinase domain. ... Crassostrea gigas A. Herpin et al. Daf-1 C. elegans Crassostrea gigas C2 domain ALK-6 E. fluviatilis C2 domain Crassostrea gigas C1 domain Wit D. melanogaster Punt D. melanogaster Act...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: " The Signal System in Interlingua — A Factor in Mechanical Translation" potx
... Russian balalaika and a resonant Spanish guitar, and so forth make fascinating material for descriptive and analytical studies in some branch of meta- linguistics. But no fundamental research ... view of translation and of mechanical translation in par- ticular is not that the signal system of departure language and target language be complete in any absolute sense of...
Ngày tải lên: 16/03/2014, 19:20