Báo cáo khoa học: " Bench-to-bedside review: Sepsis is a disease of the microcirculation" pps
... for later analysis and displayed on a black and white monitor. Because the OPS machine is a small hand-held device (Fig. 4), it can be used at the bedside for humans in the visualization of unique in ... and nose). Perfusion of the microcirculation is regulated by an intricate interplay of many neuroendocrine, paracrine, and mechano- sensory pathways [7]. These mechanism...
Ngày tải lên: 12/08/2014, 20:20
... Qualitative data as an attractive nuisance - The problem of analysis. Adm Sci Q 1979, 24(4):590-601. 34. Huberman AM, Miles MB: Data management and analysis methods. In Handbook of Qualitative ... the interviews, the analysis and the first draft. LLC, FC, DA and APC were involved in the study design, gave feedback on the analysis and helped to draft the manu- script. AS wa...
Ngày tải lên: 10/08/2014, 10:22
... Halabe-Cherem J, Malagon J, Wacher-Rodarte N, Nellen-Hummel H, Talavera-Pina J: Usefulness of the ASA scale and thoracic radiography as indicators of perioperative cardiovascular risk. Gac Med Mex 1998, ... population undergoing that type of surgery. This could be described as a statistical approach but we suggest that this is only rarely applicable due to lack of knowledge of...
Ngày tải lên: 12/08/2014, 22:21
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc
... mid-way along the chain. Northern blot analysis showed high level expression of the CYP4x1 RNA in brain and in aorta, and this was confirmed by analysis of the EST database; this showed significant ... each of three animals was analysed for Cyp4x1 RNA, and a 5-day exposure of the autoradiograph is shown; – and + represent yeast tRNA without and with RNAase treatment. (D) Thi...
Ngày tải lên: 19/02/2014, 07:20
Báo cáo khoa học: Mouse RS21-C6 is a mammalian 2¢-deoxycytidine 5¢-triphosphate pyrophosphohydrolase that prefers 5-iodocytosine pdf
... RS21-C6. Results Preparation of ITP-agarose We prepared ITP-agarose from ATP-agarose as described in Experimental procedures. Analysis of bases excised from agarose beads revealed that most adenine bases on the agarose ... 5¢Nde-mMAZG, 5¢-ATACATATG TCCACGGCTGGTGACGGTGAGCG-3¢;5¢Nco-mMAZG, 5¢-ATACCATGGCCTCCACGGCTGGTGACGGTGAGC- 3¢;3¢mMAZG-BamHI, 5¢-ATAGGATCCTTATGTGGAAG CCTGGTCTCTC-3¢; RS21...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot
... further investigation. Specifically, what is the actual structure of the glycan moiety in the native tx 5a peptide? Our NMR data indicates an a- D -Gal-(1fi3) -a- D -GalNAc-Thrstructureforthisgly- can, and a renewed ... illustrating the NOEs observed between the amino acids side chains of residues Thr10 and Ala12 and the carbohy- drate moieties of GalNAc (GN) and Gal (...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf
... CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG DS2 Skp1 S: GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCC F: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCAC DLf del.RR S: CTAGTGTCTGATGCTGCAACCACCGCCAC F: GTGGCGGTGGTTGCAGCATCAGACACTAG DLf del.KK S: ... GCCTCTTTAGAAGTCAATAGTAGG F: CCTACTATTGACTTCTAAAGAGGC S2 S: GCCTCTTTAGAAGATCAAAAGTAGG F: CTACTTTTGATCTTCTAAAGAGGC NS* S: TGGAGCCATCT...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: "How Many Words is a Picture Worth? Automatic Caption Generation for News Images" docx
... Unsurprisingly, the phrase-based system is significantly less grammatical than the gold standard and the extractive system, whereas the latter is perceived as equally grammatical as the gold standard (the ... Cadbury’s chocolate was the most likely cause of an outbreak of salmonella poisoning, the Health Protection Agency has said. About 36 out of a total of 56 cas...
Ngày tải lên: 30/03/2014, 21:20
báo cáo khoa học: "Pancreatic cancer: Surgery is a feasible therapeutic option for elderly patients" pptx
... reports. Statistical analysis The endpoint of this study was disease- specific survi- val. Disease- specific survival (DSS) was calculate d as the elapsed time from operation at our institution to death ... participated in data collection and analysis, and drafting. NL participated in drafting. IN participated in drafting. FG participated in data collection and analysis and drafting....
Ngày tải lên: 09/08/2014, 01:24
Báo cáo khoa hoc:" Resting energy expenditure is not influenced by classical music" ppsx
... and participated in its design and coordination and drafted the manuscript. All authors read and approved the final manuscript. Acknowledgements The authors are grateful to Lena Hulthén, professor ... compact disc SD – standard deviation Authors' contributions EC and HH participated in the study design, carried out the data collection and analyzed the results. FS conceived t...
Ngày tải lên: 11/08/2014, 08:20