Báo cáo khoa học: " Bench-to-bedside review: Sepsis is a disease of the microcirculation" pps

... for later analysisand displayed on a black and white monitor. Because the OPS machine is a small hand-held device (Fig. 4), it can beused at the bedside for humans in the visualization of uniquein ... andnose).Perfusion of the microcirculation is regulated by an intricateinterplay of many neuroendocrine, paracrine, and mechano-sensory pathways [7]. These mechanisms adapt to the balance between locoregional ... Nevertheless, besides ongoing discussionsabout the use of a pulmonary artery catheter in sepsis, the sole use of SvO2seems an inadequate parameter as a guideline for therapy in the restoration...

báo cáo khoa học: "Does accreditation stimulate change? A study of the impact of the accreditation process on Canadian healthcare organizations" docx

... Qualitative data as an attractive nuisance - The problem of analysis. Adm Sci Q 1979, 24(4):590-601.34. Huberman AM, Miles MB: Data management and analysis methods. In Handbook of Qualitative ... the interviews, the analysis and the first draft. LLC, FC, DA and APC were involved in the study design, gave feedback on the analysis and helped to draft the manu-script. AS was involved in the analysis and ... seeingthemselves as part of one new organization. The RHAwas a large organization composed of a number of facili-ties spread over a wide geographical area. The accredita-tion process also proved to be a...

Báo cáo khoa học: "Clinical review: How is risk defined in high-risk surgical patient management" ppt

... Halabe-Cherem J, Malagon J, Wacher-Rodarte N, Nellen-HummelH, Talavera-Pina J: Usefulness of the ASA scale and thoracicradiography as indicators of perioperative cardiovascular risk.Gac Med Mex 1998, ... populationundergoing that type of surgery. This could be described as a statistical approach but we suggest that this is only rarelyapplicable due to lack of knowledge of baseline risk and alsoto general misunderstandings ... misunderstandings of this type of statisticalanalysis. We suggest that a far more understandabledescription of high risk would be if the individual’s risk of mortality is either > 5% or twice the...

Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

... mid-way along the chain.Northern blot analysis showed high level expression of the CYP4x1 RNA in brain and in aorta, and thiswas conﬁrmed by analysis of the EST database; thisshowed signiﬁcant ... each of three animals was analysed forCyp4x1 RNA, and a 5-day exposure of the autoradiograph is shown; – and + represent yeast tRNA without and with RNAase treatment. (D)Thirty milligrams of ... followed by incubation for 1 h at 4 °C. The same procedure was followed without the addition of antigen for the nonpreadsorbed antisera. These antiserawere then used as primary antisera in the western...

Báo cáo khoa học: Mouse RS21-C6 is a mammalian 2¢-deoxycytidine 5¢-triphosphate pyrophosphohydrolase that prefers 5-iodocytosine pdf

... RS21-C6.ResultsPreparation of ITP-agaroseWe prepared ITP-agarose from ATP-agarose asdescribed in Experimental procedures. Analysis of bases excised from agarose beads revealed that mostadenine bases on the agarose ... 5¢Nde-mMAZG, 5¢-ATACATATGTCCACGGCTGGTGACGGTGAGCG-3¢;5¢Nco-mMAZG,5¢-ATACCATGGCCTCCACGGCTGGTGACGGTGAGC-3¢;3¢mMAZG-BamHI, 5¢-ATAGGATCCTTATGTGGAAGCCTGGTCTCTC-3¢; RS21-C6 forward, 5¢-GCGAGCTGGCAGAACTCTTC-3¢; ... basesand iodination at C5 of cytosine. These data suggestthat a defect of human XTP3TPA might cause a nuclear DNA replication block or mitochondrial DNAdepletion, as a result of an imbalanced...

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modiﬁed conotoxin, reveals that the glycan structure is a-D-Gal-(1ﬁ3)-a-D-GalNAc pot

... furtherinvestigation.Speciﬁcally, what is the actual structure of the glycanmoiety in the native tx 5a peptide? Our NMR data indicatesan a- D-Gal-(1ﬁ3) -a- D-GalNAc-Thrstructureforthisgly-can, and a renewed ... illustrating the NOEs observed between the amino acids side chains of residues Thr10 and Ala12 and the carbohy-drate moieties of GalNAc (GN) and Gal (G). The individual aminoacids Thr10, A la12 are ... glycosylated at position 3. Takentogether, these data identiﬁed the glycan as a- D-Gal-(1ﬁ3)- a- D-GalNAc.There a re several NOEs between the glycan and the glycopeptide side-chain atoms of tx 5a, ...

Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf

... CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGGDS2Skp1S: GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCCF: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCACDLfdel.RRS: CTAGTGTCTGATGCTGCAACCACCGCCACF: GTGGCGGTGGTTGCAGCATCAGACACTAGDLfdel.KKS: ... GCCTCTTTAGAAGTCAATAGTAGGF: CCTACTATTGACTTCTAAAGAGGCS2 S: GCCTCTTTAGAAGATCAAAAGTAGGF: CTACTTTTGATCTTCTAAAGAGGCNS* S: TGGAGCCATCTCTCAGACTTGGGF: CCCAAGTCTAGAGAGATGGCTCCADelta-lactoferrin enhances Skp1 ... GCGCCGAGGACCCCGInternal S: ACAAAGACCTGGTAACTCAInternal F: GAACCTTACTCCACAATTAGSite-directedmutagenesisDS1Skp1S: CCCTGAAGAAACCAGAGATGGCCTCTGGGATGGGACTGGGF: CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGGDS2Skp1S:...

Báo cáo khoa học: "How Many Words is a Picture Worth? Automatic Caption Generation for News Images" docx

... Unsurprisingly, the phrase-basedsystem is signiﬁcantly less grammatical than the gold standard and the extractive system, whereas the latter is perceived as equally grammatical as the gold standard (the ... Cadbury’schocolate was the mostlikely cause of an outbreak of salmonella poisoning, the Health ProtectionAgency has said. About 36out of a total of 56 cases of the illness reported betweenMarch and ... extractive and abstractive mod-els that generate image captions for news articles. A key aspect of our approach is to allow both the visual and textual modalities to inﬂuence the generation task....

báo cáo khoa học: "Pancreatic cancer: Surgery is a feasible therapeutic option for elderly patients" pptx

... reports.Statistical analysis The endpoint of this study was disease- specific survi-val. Disease- specific survival (DSS) was calculate d as the elapsed time from operation at our institution todeath ... participated in data collection and analysis, and drafting. NL participatedin drafting.IN participated in drafting. FG participated in data collection and analysisand drafting.MB participated ... drafting. RN participated in drafting. JK participated in the design of the study and drafting. JMK participated in the design of the study and drafting.All authors read and approved the final...

Báo cáo khoa hoc:" Resting energy expenditure is not influenced by classical music" ppsx

... and participated in its design and coordinationand drafted the manuscript. All authors read andapproved the final manuscript.Acknowledgements The authors are grateful to Lena Hulthén, professor ... compact discSD – standard deviationAuthors' contributionsEC and HH participated in the study design, carried out the data collection and analyzed the results. FS conceived the study, and ... professor at Dept of Clinical Nutrition, Sahlgrenska Academy at Göteborg University for valuable input during the study design.References1. James PT, Leach R, Kalamara E, Shayeghi M: The worldwide...

Xem thêm