Báo cáo khoa học: " N-acetylcysteine in clinical sepsis: a difficult marriage" pptx
... NAC infusion appear to be of vital importance. Most of the animal data were obtained in pretreatment or early post-treatment studies. In that way, they are of limited relevance to the clinical ... these mediators at the transcriptional level [5]. Only few clinical trials have investigated NAC as an adjuvant treatment in human sepsis. In this context, the study of Emet and colleagu...
Ngày tải lên: 12/08/2014, 20:20
... contributions COAM was involved in collating the information, reviewing the literature, and preparation of the manuscript. DMS was involved in collating information regarding the case and getting informed ... N-terminal domain (NTD), a DNA-binding domain (DBD), a hinge region, and a ligand-binding domain (LBD; in this case, the ligand being an andro- gen) [3]. The complete form of...
Ngày tải lên: 10/08/2014, 23:20
... 353 AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG 354 ATATATGGATCCATGGGCTGGATTCCGTGTC ... H409L GGAGTGTCCTTCTATAACATA TTTGGAGTGTCACTTAATACACC Y346F GTCACTATCATCTCCCAT GCAATGGGAGGACTTATGGTTTC S17 7A CATATGTAGATGGAGCTGGAACTGTCCCTG D38 4A GGAGTGTCACTTAAT GCACCCTTTGATGTTTG T35 2A 37...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: "Suicide in deaf populations: a literature review" ppsx
... Glickman, 2006 Prevalence study To examine demographic and clinical characteristics of deaf and hearing psychiatric in- patients A total of 64 deaf adult patients of specialist deaf unit at Westborough ... day in March 2006. The Clinical Evaluation of Risk and Functioning Scale, revised. The Allen Cognitive Levels Scale. Language Rating Scale. Deaf psychiatric inpatients rated...
Ngày tải lên: 08/08/2014, 23:20
Báo cáo khoa học: "Delineation in thoracic oncology: a prospective study of the effect of training on contour variability and dosimetric consequences" potx
... ML, Kader AS, Beckham WA, Olivotto IA: Target volume delineation for partial breast radiotherapy planning: clinical characteristics associated with low interobserver concordance. Int J Radiat ... respiratory gating. Lung Cancer 2006,51:41-51. 15. Kepka L, Bujko K, Garmol D, Palucki J, Zolciak-Siwinska A, Guzel-Szczepiorkowska Z, Pietrzak L, Komosinska K, Sprawka A, Garbaczewska A: De...
Ngày tải lên: 09/08/2014, 09:21
báo cáo khoa học: "Safety in home care: A research protocol for studying medication management" pdf
... collaborators from the project's inception, including provincial health minis- tries, national health information, patient safety, and accreditation bodies, and provincial and federal funding partners ... tex- tual data; understanding and comparing across several sources of data, synthesizing the data to capture mean- ings, constructing theoretical relationships from the data, and explai...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo khoa hoc:" Pregnancy in dialysis patients: a case series" ppt
... Sabry Address: Prince Salman Center for Kidney Diseases, Riyadh, Kingdom of Saudi Arabia Email: Khalid A Al-Saran* - khalid_aln@yahoo.co.uk; Alaa A Sabry - asabry20@yahoo.com * Corresponding author ... Central Page 1 of 4 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Pregnancy in dialysis patients: a case series Khalid A Al-Saran* an...
Ngày tải lên: 11/08/2014, 10:23
báo cáo khoa học:" Polyp in concha bullosa: a case report and review of the literature" pot
... concha bullosa polyp in a 45-year-old man. The clinical presentation, radiological and endoscopic findings, and management approach for this case are discussed. Case presentation A 45-year-old man ... Edited by: Yanagisawa E. San Diego, Singular- Thompson Learning; 2000. 2. Mirante JP, Christmas DA, Yanagisawa E: Polyps arising in a con- cha bullosa of the middle turbinate. Ear N...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo khoa học: "Year in review: Critical Care 2004 – nephrology" pptx
... of quantifying metabolic acidosis in patients admitted to an ICU: the Stewart–Figge quantitative analysis and the AG corrected for albumin and lactate (AG corr ). Metabolic acidosis was defined as standard ... accumulation of unmeasured anions, phosphate, and the attenuating effect of metabolic alkalosis secondary to hypoalbuminaemia. In ARF patients the compensatory responses are inadequ...
Ngày tải lên: 12/08/2014, 22:22
báo cáo hóa học: " Bicarbonate in diabetic ketoacidosis - a systematic review" pptx
... ketonemia, including a slower decline in ketonemia in the first hour of bicarbonate infusion in a RCT [13], and an increase in plasma acetoacetate levels during the initial three hours of bicarbo nate ... the administration of * Correspondence: Rinaldo.BELLOMO@austin.org.au 1 Department of Intensive Care, Austin Health, Melbourne, Victoria, Australia Full list of author informatio...
Ngày tải lên: 21/06/2014, 02:20