Báo cáo khoa học: "Assessment of six mortality prediction models in patients admitted with severe sepsis and septic shock to the intensive care unit: a prospective cohort study" ppt

... are proved to predict accurately mortality in severe sepsis and septic shock, then they will have the advantage of being readily available and easily incorporated into general ICU databases without ... Al-Shimemeri 1 1 Department of Intensive Care, King Fahad National Guard Hospital, Riyadh, Saudi Arabia 2 Department of Infection Prevention and Control, King Faha...

Ngày tải lên: 12/08/2014, 19:22

... baseline at the same time as the final elimination of bacteria occurs (Bekana et al. 199 6a) . This implies that an increased release of PGF 2α is an indication of the infection /in ammation in the ... (at 114 pmol/l) and the intra-assay coefficient of variation varied between 6.6% and 11.7% at different ranges of standard curve. The duration in days of the PP...

Ngày tải lên: 12/08/2014, 15:20

... 1.53 standard deviations higher than at the initiation of growth hormone therapy. His global kidney functions and levels of proteinuria and calciuria remained relatively stable. In spite of the ... palate and slight genus valgus, he had no other abnormalities. His blood pres- surewasnormalandhisboneagewas5years .A laboratory test was positive for proteinuria. He had an elev...

Ngày tải lên: 10/08/2014, 23:20

... TGGGCTTTTACCATAAACTATTTATGAAAATTATTATGGCCCACACCACTATAACTAAAGCCCACATATTTAGCAGCCCAGTT TCATTGTAAGAGACATGTTCGCTCTGGAACTAGAATTTTCTGGTTTTTGGGTATTTGTTTTCTTATGTGTAGAGAAATGATGG TAACGATTAAATGTTGTGTATTACAATTTACAATGGTAAGACGATTAATATATTTACACACAATTTTGTTGTTGCTGTAACACG TTAGTGTGTGTGATGATAGAATTTCATAAAGCTTTAACTACGAGGGGCAAAATGTTAATTCTAAATAGTTGACAGCAGAAAAA GATATGTATACATAATATAAGGATTAAAACGTAAATAATAATAAATAAGGCGAGTTA...

Ngày tải lên: 11/08/2014, 11:21

... sequence alignment and the immunoassays, and also drafted the manuscript. AK and S-MA conceived and coordinated the study, helped to draft the manuscript, and made the sta- tistical analysis. All authors ... mixed infection with genotype 1a and 1b only in center. In this study, the dominant genotype(s) in different regions of Iran consist: 1a, 1b and 3a...

Ngày tải lên: 13/08/2014, 13:20

... encoding cyt b 5 and monitored the formation of androstadienol and DHEA. As shown in Fig. 5 the stimulation of DHEA and androstadienol production from preg increases with increasing amounts of ... time of nonlabeled commercial androstadienol monitored using UV at 216 nm. This data shows that one of the metabolites obtained in assays using human and porcine P450c1...

Ngày tải lên: 08/03/2014, 08:20

... end-joining. Therefore, the telomere, its structural motifs and length, as well as recombination mechanisms and telomerase, all appear to be integral to maintaining the structural and functional integrity ... for Aging and 3 Comprehensive Cancer Center, University of Alabama at Birmingham, University of Alabama at Birmingham, AL, USA Short strands of tandem hexameric rep...

Ngày tải lên: 17/03/2014, 09:20

... University of Georgia for technical assistance with RFLP assays, and Mike Meetz and Teresa Baker at the Iowa State University Veterinary Diagnostic Laboratory for technical assistance with serology and ... Fritsch, and T. Maniatis. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York, 1989. [18] U.S. Food and Drug Administration. Nonclinica...

Ngày tải lên: 07/08/2014, 15:20

... and the rate of viral RNA clearance in individual animals was calculated by regression analysis (Table 1). Correlation analysis between the rate of viral RNA clearance and viral RNA load in serum and ... circulation, and to gain insights into relationship between viral clearance rate and viral RNA load in different tissues. Materials and Methods Collection of ser...

Ngày tải lên: 07/08/2014, 15:20

... including peanut agglutinin, wheat germ agglutinin, phytochemagglutinin E, concanavalin A, Dolichos biflorus agglutinin (DBA), soybean agglutinin (SBA) and Bandeiraea simplicifolia BS-1 (isolectin ... the six lectins examined w ere localized in the cove ring epithelia of the various organs of the flat fish and they may participate in the biodefense mechanism of th...

Ngày tải lên: 07/08/2014, 15:20