Báo cáo khoa học: "Pearsonema (syn Capillaria) plica associated cystitis in a Fennoscandian arctic fox (Vulpes lagopus: a case report" pptx

Báo cáo khoa học: "Pearsonema (syn Capillaria) plica associated cystitis in a Fennoscandian arctic fox (Vulpes lagopus: a case report" pptx

Báo cáo khoa học: "Pearsonema (syn Capillaria) plica associated cystitis in a Fennoscandian arctic fox (Vulpes lagopus: a case report" pptx

... in other cases [4]. Blood parameters, hematocrit, urea, creatinine, aspar- tate aminotranseferase (ASAT), creatine kinase (CK), ala- nine aminotransferase (ALAT), alkaline phosphatase (ALP) and ... communication Pearsonema (syn Capillaria) plica associated cystitis in a Fennoscandian arctic fox ( Vulpes lagopus : a case report Xavier Fernández-Aguilar 1 , Roland Ma...

Ngày tải lên: 12/08/2014, 18:22

4 55 0
Báo cáo khoa học: Kinetics of enzyme acylation and deacylation in the penicillin acylase-catalyzed synthesis of b-lactam antibiotics pptx

Báo cáo khoa học: Kinetics of enzyme acylation and deacylation in the penicillin acylase-catalyzed synthesis of b-lactam antibiotics pptx

... 7-ADCA and 6-APA using PAA and PGA. However they observed in all cases a saturation of the (V s /V h ) max , whereas our data indicate a linear relation for the combinations of 7-ADCA/PGA and 6-APA/PAA. Since ... of ampicillin, using phenylglycine amide as the acyl donor and 6-APA as the nucleophile, a saturation of V s /V h was observed at increasing 6-APA concentrations, indicating...

Ngày tải lên: 08/03/2014, 08:20

9 518 1
Báo cáo khoa học: "Oxcarbazepine as monotherapy of acute mania in insufficiently controlled type-1 diabetes mellitus: a case-report" pdf

Báo cáo khoa học: "Oxcarbazepine as monotherapy of acute mania in insufficiently controlled type-1 diabetes mellitus: a case-report" pdf

... G Masdrakis 1 , Konstantinos A Kontoangelos 1 , Konstantinos Makrilakis 2 , Nikolaos A Karakatsanis 1 , Charalambos Papageorgiou 1 , Nikolaos Katsilambros 2 and Constantin R Soldatos 1 Address: ... Masdrakis - vmasdrakis@med.uoa.gr; Konstantinos A Kontoangelos - kontangel@hol.gr; Konstantinos Makrilakis - kmakrila@yahoo.com; Nikolaos A Karakatsanis - dr_kar7@otenet.gr; Charalamb...

Ngày tải lên: 08/08/2014, 23:20

4 308 0
Báo cáo khoa học: "The role of adjuvant pelvic radiotherapy in rectal cancer with synchronous liver metastasis: a retrospective study" doc

Báo cáo khoa học: "The role of adjuvant pelvic radiotherapy in rectal cancer with synchronous liver metastasis: a retrospective study" doc

... contributed in patient accrual. All authors read and approved the final manuscript. Competing interests The authors declare that they have no competing interests. Table 5 Univariate and Multivariate Analyses ... Pettavel and Morgenthaler’s Staging for colorectal hepatic metastases. (A) CT imaging for stage I, (B) CT imaging for stage II, and (C) MRI imaging for stage III disease. Table 2 Pa...

Ngày tải lên: 09/08/2014, 09:20

7 328 0
Báo cáo khoa học: " The epidermal growth factor receptor (EGFR) in head and neck cancer: its role and treatment implications" pptx

Báo cáo khoa học: " The epidermal growth factor receptor (EGFR) in head and neck cancer: its role and treatment implications" pptx

... will activate an intra- cellular signalling pathway, leading to the inhibition of apoptosis, activation of cell proliferation and angiogen- esis, as well as an increase in metastatic spread potential [8]. The ... updated indi- vidual data. Lancet 2000, 355:949-955. 31. Budach W, Hehr T, Budach V, Belka C, Dietz K: A meta-analysis of hyperfractionated and accelerated radiotherapy and com-...

Ngày tải lên: 09/08/2014, 10:20

6 296 0
báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot

báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot

... Clark A, Pradhan S, Jacobsen SE: UHRF1 plays a role in maintaining DNA methylation in mammalian cells. Science 2007, 317:1760-1764. 48. Sharif J, Muto M, Takebayashi S, Suetake I, Iwamatsu A, ... [73]. Black seed (nigella sativia)belongstotheRanuncula- ceae family which grows in the Mediterranean sea and Western Asia c ountries, including P akistan, India and China [74]. This plant...

Ngày tải lên: 10/08/2014, 10:21

10 414 0
báo cáo khoa học: "Characterization of the stress associated microRNAs in Glycine max by deep sequencing" pot

báo cáo khoa học: "Characterization of the stress associated microRNAs in Glycine max by deep sequencing" pot

... Gm14:5324794:5324912 + -44 AGCCAAGAATGACTTGCCGGAA CGGGCAAGTTGTTTTTGGCTAC 337 560 475 644 438 471 175 173 Gma-m006 Gm09:16565920:16566038 - -44.7 AGAGGTGTTTGGGATGAGAGA CCTCATTCCAAACATCATCTAA 1596 102 1695 138 ... 5 filtering 5´ contaminant and trimming 3' adaptor reads, a total of 8,500,978, 9,357,545, 9,003,582 and 9,223,744 clean reads were obtained from mock, drought, salinity and...

Ngày tải lên: 11/08/2014, 11:21

32 280 0
báo cáo khoa học: " Transcriptional control of anthocyanin biosynthetic genes in extreme phenotypes for berry pigmentation of naturally occurring grapevines" pptx

báo cáo khoa học: " Transcriptional control of anthocyanin biosynthetic genes in extreme phenotypes for berry pigmentation of naturally occurring grapevines" pptx

... most abundant in 'Grignolino', 'Moscato rosa' and 'Nebbiolo', while cyanidin was the most abundant in 'Gewürztraminer'. Anthocyanin hydroxylation and expression ... anthocyanin in all cultivars that had a prevalence of tri-hydroxylated anthocyanins. By contrast, among the cultivars that had a predominance of di-hydroxylated anthocyanins, peoni...

Ngày tải lên: 12/08/2014, 05:20

10 277 0
Báo cáo khoa học: "Dobutamine reverses the vasopressin-associated impairment in cardiac index and systemic oxygen supply in ovine endotoxemia" pps

Báo cáo khoa học: "Dobutamine reverses the vasopressin-associated impairment in cardiac index and systemic oxygen supply in ovine endotoxemia" pps

... 1 Changes in mean arterial pressure (MAP), systemic vascular resistance index (SVRI), heart rate (HR) and cardiac index (CI)Changes in mean arterial pressure (MAP), systemic vascular resistance index ... indicated by increases in cardiac index (CI) and heart rate (HR) and decreases in MAP and sys- temic vascular resistance index (SVRI). As tissue oxygen requirements are typically incr...

Ngày tải lên: 13/08/2014, 03:20

9 257 0
Từ khóa:
w