Báo cáo khoa học: "Characteristics of equine summer eczema with emphasis on differences between Finnhorses and Icelandic horses in a 11-year study" pdf

... Scandinavica Open Access Research Characteristics of equine summer eczema with emphasis on differences between Finnhorses and Icelandic horses in a 11-year study Raija E Hallamaa Address: Veterinary Clinic, ... Pisteenkaari 4, 03100 Nummela, Finland Email: Raija E Hallamaa - raija.hallamaa@elisanet.fi Abstract Summer eczema, allergic dermatitis of the hor...

Ngày tải lên: 12/08/2014, 18:22

...

Ngày tải lên: 07/08/2014, 17:22

... the same number of interns, in the traditional arm would have meant that each intern admitted and cared for more patients. In other words, each intern would have had a heavier workload and, therefore, ... not compromise care. Competing interests CAC was paid an honorarium to deliver a plenary address for an annual educational conference of the ACGME. 528 ACGME = Accreditation C...

Ngày tải lên: 25/10/2012, 10:45

... 30777– 30784. 50 Mukae N, Enari M, Sakahira H, Fukuda Y, Inazawa J, Toh H & Nagata S (1998) Molecular cloning and char- acterization of human caspase-activated DNase. Proc Natl Acad Sci USA 95, 9123–9128. 51 ... polyclonal antiPARP IgG were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antimouse IgG-alexa 568 conjugate and Antiproliferative mechanism of action of...

Ngày tải lên: 30/03/2014, 10:20

... the phenomena (a) and (b) (see next paragraph). TheTMBconversionbythefreeHRPresultsinfast kinetics (black diamonds) indicating that the compara- tively slow conversion rate in case of polymersomes with inserted ... funding. Authors’ contributions NM and TD carried out design and performed study, data analysis and drafting of the manuscript. MF designed research. US contributed...

Ngày tải lên: 11/08/2014, 00:23

... EF1alpha TUB EF1alpha TUB EF1alpha TUB EF1alpha 8 GAPDH TUB RAN1 RAN1 ACT SAND ACT GAPDH ACT SAND ACT SAND 9 RAN1 CYP GAPDH TUB GAPDH GAPDH GAPDH SAND GAPDH GAPDH GAPDH GAPDH Gene expression data ... Glyceraldehyde-3-phosphate dehydrogenase SGN-U209515 (At1 g42970.1) 9.2e-79 AACAACTCACTCCTACACCGG/ GGTAGCACTAGAGACACAGCCTT 135 1.83 ± 0.09 RPS13 Ribosomal protein S13 SGN-U208260 (At4 g00100.1) 4...

Ngày tải lên: 12/08/2014, 03:21

... tundra nematodes in the abdominal cavity in the treated group. In addition, healing processes and the organization of the inflamma- tory changes in the abdominal cavity had clearly started one month ... AO and AS par- ticipated in the design and coordination of the study and were also active in writing process. TO helped and partic- ipated in statistical analyzes....

Ngày tải lên: 12/08/2014, 18:22

... naloxone training included information on naloxone, education about appropriate responses to opi- ate overdose (i.e. calling 911 and performing rescue breathing) and instructions on naloxone administration (intramuscular ... modifications; e) conducting a formal evaluation; and f) evolution of program response to naloxone. a. Political climate of naloxone distribution Propone...

Ngày tải lên: 11/08/2014, 18:20

... which inter alia led to an unacceptable concentration and inap- propriate distribution of health practitioners and exper- tise. Today, health care and expertise are concentrated in the major urban ... planning and implementation, through users' participation in developing the goals and methods of practice, and their involvement in planning and carrying out the imp...

Ngày tải lên: 11/08/2014, 05:22

... Fugelstad A, Stenbacka M, Leifman A, Nylander M, Thiblin I: Metha- done maintenance treatment: the balance between life-sav- ing treatment and fatal poisonings. Addiction 2007, 102:406-412. 40. Zanis ... methods and results section, and conducted additional literature search. AHV wrote the method and results section, performed all data analysis, prepared the tables, wrote part of...

Ngày tải lên: 11/08/2014, 18:20