Báo cáo khoa học: " A mixed methods inquiry: How dairy farmers perceive the value(s) of their involvement in an intensive dairy herd health management program" doc
... financial performance and least on the value of teamwork. Farmers, however, perceived veteri- narians as largely incompetent in areas like finances and business management and would not invite their ... their veterinarian to sit in a farm board because of what the farmers perceived as a general lack of knowl- edge on farm management and a more specific lack of...
Ngày tải lên: 12/08/2014, 18:22
... Browman GP, Snider A, Ellis P: Negotiating for change. The healthcare manager as catalyst for evidence-based practice: changing the healthcare environment and sharing experi- ence. Healthcarepapers ... Economic and Industrial Democracy 2004, 25:301-318. 32. Damanpour F: Organizational innovation: A meta-analysis of effects of determinants and moderators. Academy of manage- ment j...
Ngày tải lên: 11/08/2014, 16:21
... defined as the delineation of more than 400 breast CT scans per year for at least 2 years, and trainee physicians either had no prior experience in outlining breast CT scans or had less than 6 months ... 2008, 72:S3-S4. 2. Baglan KL, Sharpe MB, Jaffray D, Frazier RC, Fayad J, Kestin LL, Remouchamps V, Martinez AA, Wong J, Vicini FA: Accelerated par- tial breast irradiation using 3D conf...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... present in all strains (Fig. 3), although their relative ratios were altered in strains mf1 and mf2, exhibiting an increase in band D and splitting of band C. All of these bands correspond to various ... of the psbA mRNA is not affected in the mf2 strain The dramatic decrease in D1 synthesis in mf1 and mf2 strains did not correlate with any significant changes in...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: A new rice zinc-finger protein binds to the O2S box of the a-amylase gene promoter pptx
... indicates that RAMY transcription is induced by GA. The interaction between GA and ABA may be important in controlling the a- amylase gene expression. TheeffectsofGAandABAona-amylase gene transcription ... specifically to the O2S elemen t. We have also determined the importance of the amino acids within the binding domain of RAMY protein and analyzed the time course for t...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L.) during ontogeny of cotyledons pptx
... primers are shown in Fig. 10C. Radioactivity in the trichloro- ATGACCATGATTACGAATTCCGAGCTCGGTACCCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT GGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCG CAGCACTGACCCTTTTG—5’ ... FEBS TTCGAACGTACGGACGTCCA…5’ TTCGAACGTACGGACGTCCA…5’ TTCGAACGTACGGACGTCCA…5’ 3’ GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGG 5’ 32p-GTTTTCCCAGTCACGAC GTAAAACGACGGCCAGT (-20 down...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: A modelling approach to quantify dynamic crosstalk between the pheromone and the starvation pathway in baker’s yeast pot
... techniques to analyse dynamic mechanisms and measures of crosstalk. We illustrate our approach by giving an example of two signalling pathways in the budding yeast Saccharomyces cerevisiae, i.e., the mating ... in a crossac- tivation. In the same paper it is demonstrated that the invasive growth pathway can also leak into the mating pathway. However, activation of Fu...
Ngày tải lên: 30/03/2014, 10:20
Báo cáo khoa học: A natural osmolyte trimethylamine N-oxide promotes assembly and bundling of the bacterial cell division protein, FtsZ and counteracts the denaturing effects of urea docx
... effects of urea Arnab Mukherjee, Manas K. Santra, Tushar K. Beuria and Dulal Panda School of Biosciences and Bioengineering, Indian Institute of Technology Bombay, Mumbai, India Organisms, including ... protein. Proc Natl Acad Sci USA 95, 9268–9273. 51 Arakawa T & Timasheff SN (1984) The mechanism of action of Na glutamate, lysine HCl, and piperazine- N,N¢-bis (2-ethanesulfoni...
Ngày tải lên: 30/03/2014, 16:20
Báo cáo khoa học: "A Mention-Synchronous Coreference Resolution Algorithm Based on the Bell Tree" potx
... “complementing” the linking scores. The advantage is that we do not need to train a starting model. To compensate the model inaccuracy, we introduce a “starting penalty” to balance the linking and starting ... Charniak. 1998. A statistical approach to anaphora resolution. In Proc. of the sixth Workshop on Very Large Corpora. Sanda M. Harabagiu,RazvanC. Bunescu, and Steven...
Ngày tải lên: 31/03/2014, 03:20
Báo cáo khoa học: "A multiplex real-time PCR for differential detection and quantification of Salmonella spp., Salmonella enterica serovar Typhimurium and Enteritidis in meats" pps
... compared to the other two DNA extraction methods. It was indicated that the QIAamp DNA Mini Kit may be the most efficient in harvesting bacterial DNA and reducing the remaining PCR inhibitors. ... to a new microcentrifuge tube and incubated again for 10 min at 100 o C and placed immediately on ice. An aliquot of 2 μl of the supernatant was used as the template DN...
Ngày tải lên: 07/08/2014, 23:22