Báo cáo khoa học: "Metabolic profiles in five high-producing Swedish dairy herds with a history of abomasal displacement and ketosis" ppsx
... Central Page 1 of 11 (page number not for citation purposes) Acta Veterinaria Scandinavica Open Access Research Metabolic profiles in five high-producing Swedish dairy herds with a history of abomasal ... metabolic profiles, reflecting both energy metabolism and liver status around calving in high-producing herds with a high incidence of abomasal di...
Ngày tải lên: 12/08/2014, 18:22
... transcription and mRNA degradation rates. Parameter values are indicated as in Table 1, except that the rate constants on the translational level were k 3 ¼ 10 and k 4 ¼ 1, and the rates on the level of ... Physiology and Mathematical Biochemistry, BioCentrum Amsterdam, Amsterdam, the Netherlands Traditional analyses of the control and regulation of steady-state concentratio...
Ngày tải lên: 23/03/2014, 21:21
... Napoli 1,2 , Andrea Martinuzzi 2 , Giorgia Pantano 2 , Valentina De Riva 2 , Roberta Trevisan 1,2 , Elena Bisetto 1,2 , Lucia Valente 1 , Valerio Carelli 3 and Federica Dabbeni-Sala 1 1 Department of Pharmacology ... cybrids in gal-DMEM. In contrast, GSH markedly increased in cells carrying the 3460 ⁄ ND1 and 11778 ⁄ ND4 mutations, which once again showed similar behavior. A 12-...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: "Tongue carcinoma in an adult Down''''s syndrome patient: a case report" potx
... RS, Garden AS, Frankenthaler RA, et al.: Evaluation of the dose for postoperative radiation therapy of head and neck cancer: first report of a prospective rand- omized trial. Int J Radiat Oncol ... The patient was offered radical salvage surgery that was declined by the patient and his family. The patient received 2 cycles of weekly Docetaxel (30 mg/m 2 ) and weekly Carboplati...
Ngày tải lên: 09/08/2014, 04:21
Báo cáo khoa hoc:" Retroperitoneal haemorrhage in renal angiomyolipoma causing hepatic functional decompensation: a case report" ppsx
... 'Lenk's triad' of symptoms include flank or abdominal pain, a palpable or tender mass and haematuria 4 . Other symptoms may include fever, vomiting, anaemia, renal failure and hypo- tension ... multiple, bilateral and are associated with rapid growth and an increased risk of haemorrhage [4,7]. A sporadic and rare form of angiomyolipoma is also found where...
Ngày tải lên: 11/08/2014, 10:22
báo cáo khoa học: " Pollen development in Annona cherimola Mill. (Annonaceae). Implications for the evolution of aggregated pollen" pdf
... that originally looked outwards rotate inward to face each other. A similar rotation has been reported previously in other Annonaceae [A. glabra and A. montana [22] and Cymbopetalum [23], and also ... proxi- mal reduction of the exine in Annonaceae [59]. A. cher- imola pollen is inaperturate and germinates in the proximal face, showing a large area of unprotected intin...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo khoa học: "Steroid use in PROWESS severe sepsis patients treated with drotrecogin alfa (activated)" pot
... mortality associated with severe sepsis and/ or septic shock [22]. Adrenal replacement therapy in patients with adrenal failure may be a logical addition to standard care in patients with severe ... characteristics (e.g. age) were analyzed using one- way analysis of variance. Categorical baseline characteristics were analyzed using Pearson's χ 2 test. Figure 1 Patient po...
Ngày tải lên: 12/08/2014, 22:22
Tài liệu Báo cáo khoa học: Purified RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf
... 3027 cellular retinaldehyde-binding protein. After 2 h of incuba- tion at 37 °C in the dark, the generated retinoids were extracted with 300 lL of methanol and 300 lL of hexane and analyzed by normal-phase ... activity after reassociation with a phospholipid membrane Olga Nikolaeva, Yusuke Takahashi, Gennadiy Moiseyev and Jian-xing Ma Departments of Cell Biology and Me...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt
... GGAT CCATGGTCATGGAAACATATCCATA AATCGG and CCAT CCATGGTCAGTTGATAGGAGC TGTGAAGAAAAC, respectively (all incorporating NcoI site, underlined). The resulting fragments were cloned into pEG202 using EcoRI and ... plasmid encoding TAP-tag only was gener- ated similarly to pchSUV3-650–786-TAP with the exception that the forward primer had the following sequence: CGT CTCGAGATGGAAA AGAGAAGA TGGAA...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx
... in bands migrating between the free a1 AT and the intact serpin–protease complex. Mutating Arg122 to Ala (R12 2A) in cationic and anionic trypsins abolished the major proteolytic bands, confirming ... cationic and anionic trypsins, demonstrating that Arg198 is the critical determinant of resistance against a1 AT (Fig. 2A, B). Figure 2A also indicates that the apparent stoichio-...
Ngày tải lên: 30/03/2014, 10:20