Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx

... Veterinaria Scandinavica Open Access Research Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in ... in canine mammary gland cancer Renata A Sobral 1 , Suzana T Honda 1 , Maria Lucia H Katayama 1 , Helena Brentani 2 , M Mitzi Brentani 1...

Ngày tải lên: 12/08/2014, 18:22

... a few distinguishable macrochromosomes and a much higher number of small microchromosomes, visualized as dots on metaphase preparations and usually classified by decreasing ... essential to allow a precise localization of genes and markers, leading to completed genetic maps. For this purpose, a collection of large insert BAC (bacterial...

Ngày tải lên: 09/08/2014, 18:21

... concentration of partially active GC vari- ants, as demonstrated by increased cellular GC activity, an increased concentration of lysosomal GC glyco- forms and increased colocalization of GC with ... mechanisms. Proc Natl Acad Sci USA 103, 13813–13818. 29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de- oxynojirimycin as a...

Ngày tải lên: 18/02/2014, 16:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting PCR prod- ucts, ... PK activity was modulated. At increased PK activity we found an almost proportional increase in formate and acetate produc...

Ngày tải lên: 19/02/2014, 17:20

... 4 Histological and immunohistochemical evaluation of superficial areas (groups 1 and 2 ). (A) Hematoxylin and eosin staining showing cords and islands of polygonal cells without atypia in a myxoid ... adenomas (PAs) are the most common benign tumors arising in salivary glands and their malig- nant transformation to carcinoma e x pleomorphic ade- nomas(CXPAs)accountsforbe...

Ngày tải lên: 10/08/2014, 22:20

... regional health authorities and hospitals in Canada. Social Science and Medicine 2006, 62:964-76. 28. Lomas J: Using 'linkage and exchange' to move research into policy at a Canadian foundation. ... politics, and maintaining work- life balance. Participants thought that research mentoring included identification of sources of funding, review of grants and manus...

Ngày tải lên: 11/08/2014, 16:20

... in ICU patients calls for a measure of hyperglycaemia similar to what HbA1c is in diabetic outpatients • Admission glucose, mean glucose and morning glucose all have drawbacks as indicators of ... mortality was achieved in patients who were treated according to a protocol that aimed to achieve normoglycaemia. Thus, the logical aims of glucose control are to elimina...

Ngày tải lên: 12/08/2014, 20:20

... recovered differentially based on varying stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis ... turned to combinatorial approaches that permit the rapid analysis of libraries of protein variants. Phage- display has proved to be a powerful tool for analyzing...

Ngày tải lên: 19/02/2014, 12:20

... state; all other atoms are as- sumed to be false. Actions have a number of param- eters, as well as a precondition and effect, both of which are logical formulas. When a planner tries to apply an action, ... the planning operators. After a brief review of LTAG and PDDL, we first focus on syntax alone and show how to cast the problem of generating grammatically...

Ngày tải lên: 20/02/2014, 12:20

... model. Linear discriminant analysis (LDA).Thisstatistical multivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass variance, ... principles to solve problems [14]. Many parameters can be adjusted for increasing the efficiency of the algorithm. The data were analysed with a window of five wavenumbers, ass...

Ngày tải lên: 21/02/2014, 03:20