Báo cáo khoa học: " Joint disorder; a contributory cause to reproductive failure in beef bulls" doc

... 7 (page number not for citation purposes) Acta Veterinaria Scandinavica Open Access Research Joint disorder; a contributory cause to reproductive failure in beef bulls? Ylva Persson* 1 , Lennart ... fraying of less than 30% of the articular cartilage with single erosion <1 cm in diameter and superficial wear lines. Mild OA in the tarsocrural, talocalcaneus, and pro...

Ngày tải lên: 12/08/2014, 18:22

... current actual embedding is transformed into a probability by exponentiating and then normalizing. Mnih and Hinton (2009) speed up model evaluation during training and testing by using a hierarchy to ... representation induction, as was the in- domain data. We are curious to investigate this phenomenon further. Ando and Zhang (2005) present a semi- supervised learning algorithm cal...

Ngày tải lên: 20/02/2014, 04:20

... expressed in S 2 cells as a cytosolic enzyme and also as a membrane peptidase. In terms of proctolin degrading activity, a dipeptidyl aminopeptidase activity was shown to hydrolyse proctolin in insects ... myotropic neuropeptide proctolin (Arg-Tyr-Leu-Pro-Thr) have been compared to those of enkephalins. Indeed, a dipeptidyl aminopeptidase activity appears as one major procto...

Ngày tải lên: 17/03/2014, 10:20

... CGCTGCAGTAAGAGCAGTAAACCCG Vps4 SalIR GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT Vps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG Vps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATC YEE ... F CTGGACACAGCCACGCAGTATACAGCATACTATAACGG YEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG IRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG IRA R CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGG Table 3. Plasmids...

Ngày tải lên: 23/03/2014, 09:20

... quantity of interest and the subject of systematic study, we have what is known in scale-aware disciplines as multi-scalar analysis, of which fractal analysis is a variant. Although a certain ... the fact that varying win- dow size fundamentally affects what is being measured (both in the raw data sense and linguis- tically speaking) and so impacts upon the output qualitatively....

Ngày tải lên: 24/03/2014, 03:20

... relationships Kate has finished her training year and is working as a 0.6 full-time equivalent salaried family doctor in a busy practice in central London. Brimming with enthusiasm after winning a prize ... undertaking her training year. As part of this vocational training, she has to conduct an audit project. Her trainer (a senior clinician) tells her that the practice has not...

Ngày tải lên: 11/08/2014, 05:22

... levels in HeLa cells after treatment with increasing concentration of daunorubicin, a known anticancer agent that is highly cytotoxic by a number of proposed mechanisms – intercalation into DNA among ... CP-31398 directly. It is interesting to note that CP-31398 can intercalate into DNA as reported by Rippin et al. [10]. This intercalation is probably toxic to the cell and likely in...

Ngày tải lên: 11/08/2014, 08:20

... under a light microscope to investigate the early phase of infection in regards to pathogen penetration and early host response. Adaxial (lemma) and abaxial (palea) foliar tissues were dissected and ... primary concern because Fg and Fc produce a number of secondary metabolites within infected grain that are toxic to human and animal consumers. The most prevalent Fusarium mycotoxi...

Ngày tải lên: 11/08/2014, 11:20

... modest in most cases) of currently available anticancer drugs because these agents, including classical cytotoxic drugs and newer ‘targeted’ agents, invariably interact with targets that are shared ... to drugs such as etoposide that lead to DNA damage after binding to topoisomerase II [18,19]. Loss of pRB increases S-phase entry and increases topoisomerase II levels. In addit...

Ngày tải lên: 11/08/2014, 12:20

... relationships Kate has finished her training year and is working as a 0.6 full-time equivalent salaried family doctor in a busy practice in central London. Brimming with enthusiasm after winning a prize ... person, documents, Table 1: Case Study, Year 1. Implementing best practice in a receptive environment Kate is starting out as a family doctor in a rural practice and i...

Ngày tải lên: 11/08/2014, 16:20