Báo cáo khoa học: " Joint disorder; a contributory cause to reproductive failure in beef bulls" doc
Báo cáo khoa học: " Joint disorder; a contributory cause to reproductive failure in beef bulls" doc
... 7
(page number not for citation purposes)
Acta Veterinaria Scandinavica
Open Access
Research
Joint disorder; a contributory cause to reproductive failure in beef
bulls?
Ylva Persson*
1
, Lennart ... fraying of less
than 30% of the articular cartilage with single erosion <1
cm in diameter and superficial wear lines. Mild OA in the
tarsocrural, talocalcaneus, and pro...
Tài liệu Báo cáo khoa học: "Word representations: A simple and general method for semi-supervised learning" doc
... current actual embedding is transformed
into a probability by exponentiating and then
normalizing. Mnih and Hinton (2009) speed up
model evaluation during training and testing by
using a hierarchy to ... representation induction,
as was the in- domain data. We are curious to
investigate this phenomenon further.
Ando and Zhang (2005) present a semi-
supervised learning algorithm cal...
Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc
... expressed in S
2
cells as a cytosolic enzyme
and also as a membrane peptidase.
In terms of proctolin degrading activity, a dipeptidyl
aminopeptidase activity was shown to hydrolyse proctolin
in insects ... myotropic
neuropeptide proctolin (Arg-Tyr-Leu-Pro-Thr) have been
compared to those of enkephalins. Indeed, a dipeptidyl
aminopeptidase activity appears as one major procto...
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
... CGCTGCAGTAAGAGCAGTAAACCCG
Vps4 SalIR GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT
Vps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG
Vps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATC
YEE ... F CTGGACACAGCCACGCAGTATACAGCATACTATAACGG
YEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG
IRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG
IRA R CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGG
Table 3. Plasmids...
Báo cáo khoa học: "Co-dispersion: A Windowless Approach to Lexical Association" ppt
... quantity of interest
and the subject of systematic study, we have
what is known in scale-aware disciplines as
multi-scalar analysis, of which fractal analysis is
a variant. Although a certain ... the fact that varying win-
dow size fundamentally affects what is being
measured (both in the raw data sense and linguis-
tically speaking) and so impacts upon the output
qualitatively....
báo cáo khoa học: " Sticky knowledge: A possible model for investigating implementation in healthcare contexts" pot
... relationships
Kate has finished her training year and is working as a 0.6 full-time equivalent salaried family doctor in a busy practice in central London. Brimming
with enthusiasm after winning a prize ... undertaking her training year. As part of this vocational training, she has to conduct
an audit project. Her trainer (a senior clinician) tells her that the practice has not...
Báo cáo khoa hoc:" CP-31398, a putative p53-stabilizing molecule tested in mammalian cells and in yeast for its effects on p53 transcriptional activity" potx
... levels in HeLa cells after
treatment with increasing concentration of daunorubicin,
a known anticancer agent that is highly cytotoxic by a
number of proposed mechanisms – intercalation into
DNA among ... CP-31398
directly. It is interesting to note that CP-31398 can
intercalate into DNA as reported by Rippin et al. [10]. This
intercalation is probably toxic to the cell and likely
in...
báo cáo khoa học: "Brachypodium distachyon: a new pathosystem to study Fusarium head blight and other Fusarium diseases of wheat" pdf
... under a light microscope to investigate the early
phase of infection in regards to pathogen penetration
and early host response. Adaxial (lemma) and abaxial
(palea) foliar tissues were dissected and ... primary concern because Fg and Fc produce
a number of secondary metabolites within infected grain
that are toxic to human and animal consumers. The
most prevalent Fusarium mycotoxi...
báo cáo khoa học: " Synthetic lethality: a framework for the development of wiser cancer therapeutics" docx
... modest in most cases) of
currently available anticancer drugs because these agents,
including classical cytotoxic drugs and newer ‘targeted’
agents, invariably interact with targets that are shared ...
to drugs such as etoposide that lead to DNA damage after
binding to topoisomerase II [18,19]. Loss of pRB increases
S-phase entry and increases topoisomerase II levels. In
addit...
báo cáo khoa học: " Sticky knowledge: A possible model for investigating implementation in healthcare contexts" ppt
... relationships
Kate has finished her training year and is working as a 0.6 full-time equivalent salaried family doctor in a busy practice in central London. Brimming
with enthusiasm after winning a prize ... person, documents,
Table 1: Case Study, Year 1. Implementing best practice in a receptive environment
Kate is starting out as a family doctor in a rural practice and i...
Từ khóa: