Báo cáo y học: " Human lung cancer cells express functionally active Toll-like receptor 9" potx

Báo cáo khoa hoc:" Human haematopoietic stem cells express Oct4 pseudogenes and lack the ability to initiate Oct4 promoter-driven gene expression" ppt

... dimerictrans-activator of gene expression or synergistically withother transcription factors such as Sox2 [3]. U ntilrecently, Oct4 was thought to be expressed exclusivelyin embryonic ste m (ES ) cells and primordial ... IgG1,cloneYB5.B8,BDPhar-Mingen Biosciences, UK). The percentage yield and pur-ity of isolated cells was ascertained by flow cytometry:the mononuclear cell fraction consisted of 4% c-kit+ cells, ... CellTechnologies Inc, UK). Cells were plated at a densityof ~2 × 105cell/ml and media changed every 4-5 days. Human Cell LinesThe embryoni c car cinoma (EC) cell line 2102Ep (kindlyprovided by Prof PW Andrews,...

Báo cáo y học: " Human Papillomavirus in Brazilian women with and without cervical lesions" potx

... likely type pre-viously reported as SW1 [40]. One hundred and twelvewomen were found to be infected by a single HPV typeand 11 showed co-infection, 9 of which by two typesand two by three types. ... Betapapillomavirus and a likely new type, previouslyreported, from 132 women positive for the virus analysed by Hybrid Capture II assay. These women were infectedby a single or multiple HPV types and 142 HPV ... denaturing conditions. In this present study, onlyHPV+ women diagnosed previously by HCII assay wereanalyzed, totalizing 297 women. This study wasapproved by the Ethics Committee of the InstitutoNacional...

Báo cáo y học: " CD8 positive T cells express IL-17 in patients with chronic obstructive pulmonary disease" ppsx

... FEV1/forced vital capacity (FVC) ≤ 0.70;no history o f asthma, atopy (as assessed by an allergyskin prick test during screening) or any other active lung disease. Patients on home oxygen or with raisedcarbon ... inflammatorydisease of the lung. The nature of the immune reaction in COPD raises the possibility that IL-17 and relatedcytokines may contribute to this disorder. This study analyzed the expression ... tissue sections y ielding approximately 300 to 500 cells per section. The sections were pooled to yieldapproximate ly 3000 to 5000 cells per sample. As CD4+ cells were already known to ex press...

Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx

... P4H isoenzyme gene expression in articular chondrocytes aggregatesCollagen P4H isoenzyme gene expression in articular chondrocytes aggregates. Prolyl 4-hydroxylase (P4H)α isoenzyme gene expression ... 25:402-408.52. Takahashi Y, Takahashi S, Shiga Y, Yoshimi T, Miura T: Hypoxicinduction of prolyl 4-hydroxylase alpha (I) in cultured cells. JBiol Chem 2000, 275:14139-14146.53. Chun Y- S, Yeo E-J, Choi ... 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTTCOL1A2, collagen type I alpha 2; COL2A1, collagen type II alpha 1; HIF, hypoxia inducible factor; P4H, prolyl 4-hydroxylase; PHD, HIF prolyl hydroxylase; SOX, Sry-related HMG box-9.Arthritis...

Báo cáo y học: " Human Th17 cells." potx

... played by Th17 cells in the pathogenesis of human autoimmune disorders, although very probable, is not yetproven. More importantly, the respective roles of Th17 andTh1 cells in inflammatory ... although IL-12 polarized cells (prototypic Th1 cells) expressed genes associated with cytotoxicity, such asthose encoding IFN-γ, Fas ligand and granzymes, IL-23polarized cells expressed genes associated ... inducedevelopment of IL-17 producing cells. Finally, van Beelen andcolleagues [66] demonstrated that human Th17 cells couldbe derived only by memory, and not by naïve, T cells, and thiseffect was due...

Báo cáo y học: "Human infrapatellar fat pad-derived stem cells express the pericyte marker 3G5 and show enhanced chondrogenesis after expansion in fibroblast growth factor-2" potx

... donkey anti-goat IgG biotin-conjugated secondary antibody (Santa Cruz Biotechnology)for collagen type I and collagen type II and donkey anti-rabbitIgG biotin-conjugated secondary antibody for ... heterogeneity in the cell popula-tion but was an epitope expressed by all cells, but only duringpart of the cell cycle. It is thus possible that IPFP-derived cells were a homogenously 3G5-positive ... anti -human collagen typeI (C-18 polyclonal), collagen type II (N-19 polyclonal) (bothfrom Santa Cruz Biotechnology), or rabbit anti -human aggre-can (BR1) (all at 1:100 dilution) followed by washing...

Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf

... (bothfor naive and memory T cells) , cytotoxic T-lymphocyteformation, IFN-γ production by Th1 cells, and interleukin-4 pro-duction by Th2 cells. [39,40]. The ability to decrease IFN-γproduction, ... ofmesenchymal progenitors. Stem Cells 2005, 23:220-229.26. Yen BL, Huang HI, Chien CC, Jui HY, Ko BS, Yao M, Shun CT, YenML, Lee MC, Chen YC: Isolation of multipotent cells from human term ... Le Blanc K: Immunomodulatory effects of fetal and adult mes-enchymal stem cells. Cytotherapy 2003, 5:485-489.39. Aggarwal S, Pittenger MF: Human mesenchymal stem cells modulate allogeneic immune...

Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot

... evaluation.Functional analysis of hES-DCs by Mixed Leukocyte Reaction (MLR) assay and antigen uptake assayThe T cell stimulatory capacity of DCs derived from hES cells CD34+ progenitor cells was assessed by co-incubat-ing ... 4µg/ml polybrene was used. Infected cells were visualizedby fluorescence microscopy to identify GFP expressing cells. Infected culture supernatants were also assayed forp24 antigen by ELISA using ... He JQ, Ma Y, Lee Y, Thomson JA, Kamp TJ: Human embryonicstem cells develop into multiple types of cardiac myocytes:action potential characterization. Circ Res 2003, 93:32-39.7. Assady S, Maor...

Báo cáo y học: " Human herpesvirus 6 major immediate early promoter has strong activity in T cells and is useful for heterologous gene expression" ppsx

... putative immediate-earlylocus of human herpesvirus 6. J Virol 1991, 65:5381-5390.30. Takemoto M, Koike M, Mori Y, Yonemoto S, Sasamoto Y, Kondo K,Uchiyama Y, Yamanishi K: Human herpesvirus 6 ... onheterologous expression in mammalian cells. Nucleic Acids Res 1991,19:3979-3986.25. Somboonthum P, Yoshii H, Okamoto S, Koike M, Gomi Y, Uchiyama Y, Takahashi M, Yamanishi K, Mori Y: Generation ... performed and analyzed the experiments, and drafted the manuscript.TM participated in the design of the study partly and performed theexperiments partly. KY analyzed the study. YM participated...

Báo cáo y học: " CD39+ Regulatory T cells suppress generation and differentiation of Th17 cells in human malignant pleural effusion via a LAP-dependent mechanism" pps

... biopsy was performedwhen the results of pleural fluid analysis were suggestiveof malignancy.Flow CytometryThe expression markers on T cells from MPE and bloodwere determined by flow cytometry ... Respiratory Diseases, Key Laboratory of Pulmonary Diseasesof Health Ministry, Union Hospital, Tongji Medical College, HuazhongUniversity of Science and Technology, China.2Institute of RespiratoryDiseases, ... themanufacturer’s instructions. The purity of naïve CD4+T cells was > 97%, as measured by flow cytometry.CD4+T cells were also stained with CD4-PerCP-Cy5.5, CD25-PE, and CD39-FITC, (eBiosciences),...

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật