Báo cáo y học: " Respiratory Research: a new multidisciplinary journal for a new age " doc

... Jeffery Drazen of Harvard University, who was the North American Editor-in-Chief during the early stages when Respiratory Research was being set up. He played a very active and enthusiastic role ... text of primary articles. The full text of all primary research articles will, therefore, be widely available online free of charge, ensuring that all research findings are easily accessible t...

Ngày tải lên: 12/08/2014, 18:20

... complicated. Cardiac arrest may be due to mechanical failure and external cardiac massage (ECM) is not appropriate, as stated by the European Society of Cardio thoracic Sur- gery [1]. We present a ... cannula directly beneath the sternum. The perioperative team had no alternatives to external cardiac massage other than rapid deployment of extra-corporeal membrane oxygenation for mechanica...

Ngày tải lên: 10/08/2014, 09:21

... Critical Care Vol 13 No 6 Terblanche and Adhikari Page 2 of 2 (page number not for citation purposes) cally plausible? Second, do statins beneficially (and safely) modulate the immune response and ... colleagues in rheumatology, cardiology and onco- logy, who have explored and described mechanistic path- ways - paths reliably connecting biological plausibility and effect with organ performa...

Ngày tải lên: 13/08/2014, 20:21

... investigators found that predictions of mortality and morbidity varied widely even for identical vignettes. They also found that age, high body mass index and early-stage lung cancer were all associated ... a higher predicted mortality and a recommendation to limit life support despite an identical APACHE II score. Finally, they found that early-stage lung cancer was associated with a...

Ngày tải lên: 13/08/2014, 16:21

... Americans: Be Active, Healthy, and Happy! Washington, D. C.; 2008. 2. Public Health Agency of Canada & Canadian Society for Exercise Physiology: Canada’s Physical Activity Guide to Healthy Active ... Living for Children. Ottawa, Ont.: Public Health Agency; 2002. 3. Public Health Agency of Canada & Canadian Society for Exercise Physiology: Canada’s Physical Activity Guide to Heal...

Ngày tải lên: 14/08/2014, 08:20

... intro- duced an MET service using the first year of data as baseline and the second year as comparator. Finally, an additional and similar analysis was performed for hospitals that had partici- pated ... in-hospital CAs in a number of single-centre before-and-after studies [5-9]. A ANZ = Australia and New Zealand; ANZICS = Australian and New Zealand Intensive Care Society; ANZICS-AP...

Ngày tải lên: 25/10/2012, 10:35

... sincere gratitude to all the Pediatric Surgery Unit staff at the Maternity And Child Teaching Hospital, Al-Qadisiya, Iraq, for their assistance. Thanks also go to Dr Luaay E Alkhury (pathologist), ... prenatal history was unremarkable. Our patient experienced snorting, nasal flaring, and an inability to feed on initial evalua- tion. A physical examinati on revealed no gross craniofa- cial...

Ngày tải lên: 10/08/2014, 23:21

... Kothari* - akothari@uwo.ca; Nancy Edwards - nedwards@uottawa.ca; Nadia Hamel - NadiaH@uottawa.ca; Maria Judd - maria.judd@chsrf.ca * Corresponding author Abstract Background: 'Is research working ... working for you? validating a tool to examine the capacity of health organizations to use research Anita Kothari* 1 , Nancy Edwards 2 , Nadia Hamel 3 and Maria Judd 4 Address: 1 Uni...

Ngày tải lên: 11/08/2014, 05:21

... index files are designated from which all analyses will be con- ducted. A TREC-specific data unit has been established and is currently staffed by two data analysts, a data man- ager, and two trainees. ... Residents and Size of Facility, Canada, Provinces and Territories, Annual (Number). In CANSIM (database) Ottawa: Minister of Industry, Can- ada; 2009. 38. Statistics Canada: Population...

Ngày tải lên: 11/08/2014, 05:21

... RT-PCR Target Sense primer Anti-sense primer Annealing (°C) HA1 CAGATGCAGACACAATATGT TAGTGGGGCTATTCCTTTTA 48 HA7 TCTGCCATTCCAAAACATCA GCAGTTCCTTCTCCTTGTGC 48 Bahgat et al. Virology Journal 2011, 8:27 http://www.virologyj.com/content/8/1/27 Page ... S, Tsuchihashi S, Ogawara M, Masuda K, Yamaoka K, Takahashi M, Sano T: Purification, characterization, and localization of a novel trypsin-lik...

Ngày tải lên: 11/08/2014, 21:21