Báo cáo y học: "Road trips and resources: there is a better way" pot
Báo cáo y học: "Road trips and resources: there is a better way" pot
... battery and location and quantity of air and oxygen tanks.Swoboda et al. Critical Care 1997, 1:105http://ccforum.com/Page 2 of 7RESEARC H Open AccessRoad trips and resources: there is a better ... intrahospitaltransport.Using the statistical package Crunc h (Verion 4,CrunchSoftware,Oakland,California,USA),thethreegroups were analyzed for differences using a one-wayanalysis of variance ... 1988,28:1020-1025.doi:10.1186/cc113Cite this article as: Swoboda et al.: Road trips and resources: there is a better way. Critical Care 1997 1:105.Submit your next manuscript to BioMed Central and take full advantage of: •...
- 7
- 329
- 0
Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx
... (CGTCTGGTATCTGGGTAT/AATGTCCTTTTCTAGTCC), D5 9A (CGTCTGGTAGCTGGGTAT/AATGTCCTTTTCTAGTCC),P/W(AGTTATGAATGGTGGCATTTTCG/GATACCGGTGATCTCTTG) and Q/V (GGAAAAAGAAGTGCGACG/GTACGATACCCATCTACC), respectively ... the VanC phenotype, VanXYCmust specific-ally hydrolyseD-Ala-D-Ala with minimal activity againstD-Ala-D-Ser, a very different type of specificity.VanXYC, VanX-type and VanY-type enzymes ... hydrolysisof UDP-MurNAc-pentapeptide[Ala]. However, its activitywas comparable with that of D59S and His6–VanXYC.Therates of hydrolysis ofD-Ala-D-Ala and UDP-MurNAc-pentapeptide[Ala]...
- 7
- 414
- 0
Báo cáo Y học: Purification and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc
... (2002) Genetic analysis of the archaeon Methanosarcinabarkeri Fusaro reveals a central role for Ech hydrogenase and ferredoxin in methanogenesis and carbon fixation. Proc. NatlAcad.Sci.USA99, 5632–5637.25. ... to an apparent molecular mass of 120 kDa.Protein was concentrated by ultrafiltration and analyzed bySDS/PAGE.Determination of enzyme activitiesThe assays were routinely carried out under anoxic ... dehydrogenase activity elutedfrom this column with an apparent molecular mass of120 kDa. An SDS/PAGE analysis of this fraction showedone protein band with an apparent molecular mass of62 kDa...
- 10
- 376
- 0
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt
... ciliate Tetrahymena pyriformis [19,20],in the diplomonadide Giardia lamblia and the parabasilideTrichomonas vaginalis [21]. From these analyses the genesencoding CCT subunits in protozoa appeared ... analysis of a b-tubulin isotypefrom the Antarctic ciliateEuplotes focardiiSandra Pucciarelli1,2, Cristina Miceli1 and Ronald Melki21Dipartimento di Biologia Molecolare, Cellulare e Animale, ... b-T1 was synthesized asreported by Gao et al. [31] using the construct described inthe Materials and methods section and analysed by SDS/PAGE. [35S]b-T1 has an apparent molecular mass indistin-guishable...
- 7
- 500
- 0
Báo cáo y học: "Cognitive status and behavioral problems in older hospitalized patients" pot
... ethnic-ity, 30 patients were Caucasian, 9 were African American,1 was Hispanic, 1 was Asian Pacific, and 1 was unreport-ed. Ten patients lived alone, and 19 patients had a pasthistory of psychiatric ... staff can have limited shifts and care formore than one patient at a time they may under-reportcertain behavioral changes, particularly apathy and de-pressive symptoms. Alternatively, distress ... ethnicity, psychiatric history, and perform-ance at admission on the MMSE and the GDS. Our analy-sis revealed that a statistically significant proportion of thevariance of the NPI-Q was accounted...
- 8
- 406
- 0
Báo cáo y học: " Phosphatidylserine receptor and apoptosis: consequences of a non-ingested meal" pptx
... hypotheses.Disposing of dying cell: a fine balancebetween proinflammatory and anti-inflammatory signalsPhagocytosis of apoptotic cells is known to be an anti-inflammatory [15] and immunologically silent ... of the dying cellsbecame leaky, and the usually anti-inflammatory clearance149Available online http://arthritis-research.com/content/6/4/147becomes proinflammatory. However, Kunisaki and coworkers ... observation is consistent with the hypothesis thatwhen cells undergoing apoptosis are not properly cleared,they may enter late stages of apoptosis and secondarynecrosis consecutively. The membranes...
- 4
- 332
- 0
Báo cáo y học: "ITGAV polymorphism and disease susceptibility in a Japanese rheumatoid arthritis population" ppsx
... linkage analysis of rheumatoidarthritis, including covariates. Arthritis Rheum 2004, 50:2757-2765.5. Iwamoto T, Ikari K, Inoue E, Toyama Y, Hara M, Yamanaka H,Tomatsu T, Momohara S, Kamatani ... European Caucasian population: a family-based study.Arthritis Res Ther 2007, 9:R63.2. Friedlander M, Brooks PC, Shaffer RW, Kincaid CM, Varner JA,Cheresh DA: Definition of two angiogenic pathways ... odds ratio is under 1.67, thepower is limited to below 0.8, and this may represent a studylimitation.Despite its association with RA in Caucasian populations, anassociation of the ITGAV gene...
- 2
- 313
- 0
Báo cáo y học: "Biologic activity and safety of belimumab, a neutralizing anti-B-lymphocyte stimulator (BLyS) monoclonal antibody: a phase I trial in patients with systemic lupus erythematosus" potx
... antibodies, ANAs,immunoglobulins (IgG, IgM, IgE, and IgA), and complement(C3 and C4). Anti-dsDNA antibodies and ANAs were meas-ured by Farr assay (Specialty Laboratories, Santa Monica, CA,USA) and ... BlyS: B-lymphocyte stimulator; dsDNA: double-stranded DNA; ELISA: enzyme-linked immunosorbent assay; HAHA: human anti-human antibody; mAb: monoclonal antibody; PGA: Physician's Global Disease ... belimumab in SLE patients withstable, mild to moderate disease activity and demonstrated itssafety, biologic activity, and pharmacokinetics.Materials and methodsPatientsPatients aged 18 years...
- 15
- 478
- 0
Báo cáo y học: "HIV, appendectomy and postoperative complications at a reference hospital in Northwest Tanzania: cross-sectional study" doc
... 1:252-255.18. Tanzania HIV/AIDS and Malaria Indicator Survey 2007-08: PreliminaryReport. Tanzania Commission for AIDS (TACAIDS).27.19. Alvarado A: A practical score for the early diagnosis of acuteappendicitis. ... common among patients with append icitis in Tanzania, and are associated withsevere morbidity, postoperative complications and longer hospital stays. Early diagnosis of appendicitis and promptappendectomy ... thestudy was assessed by measuring the level of absoluteCD4+count using FACS calibre machine (BD-Becton,Dickinson and Company, USA).Data management and analysisData were sorted out and coded...
- 6
- 345
- 0
Báo cáo y học: "Technical phosphoproteomic and bioinformatic tools useful in cancer research" potx
... reversedphase chromatography (RP) [39] A positively charged analyte is attracted to a negativelycharged solid-support, and a negatively charged analyte is attracted to a positively charged solid-support ... inexplic-able focal efficacy. The vinca alkaloids are useful fortreating lymphoma, neuroblastoma and nephroblasto-mas, whereas taxol is useful for advanced breast cancer and ovarian cancer. It is ... pooled and usually fractionatedby nano liquid chromatography and analyzed by tandemMS (MS/MS). The fragmentation of the attached taggenerates a low molecular mass reporter io n that can beused...
- 14
- 479
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo tự học hướng dẫn sử dụng phần mềm mô phỏng proteus potprocesses and may contribute to morbidity and mortality there is a clear association between reduced foetal hrv and intrauterine death foetal acidthe percentage of students who got below average marks is rather high 28 60 considering the test items 3 6 and 11 there is a large number of students who giving wrong order of qualifiers namely 49 58 and 61 students out of 70 ones relativelybáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ