Báo cáo y học: "The gene expression profile of preclinical autoimmune arthritis and its modulation by a tolerogenic disease-protective antigenic challeng" ppt

Báo cáo y học: "The gene expression profile of preclinical autoimmune arthritis and its modulation by a tolerogenic disease-protective antigenic challeng" ppt

Báo cáo y học: "The gene expression profile of preclinical autoimmune arthritis and its modulation by a tolerogenic disease-protective antigenic challeng" ppt

... Alleva D, Acosta HM, Martinez C, Ortega A, Lopez A, Araiza-Casillas R, Zlotnik A: Gene array analysis comparison between rat collagen-induced arthritis and human rheumatoid arthritis. Scandinavian ... acceptance. Copyedited and fully formatted PDF and full text (HTML) versions will be made available soon. The gene expression profile of preclinical autoimmune arthr...
Ngày tải lên : 12/08/2014, 18:20
  • 48
  • 317
  • 0
Báo cáo y học: "Microarray gene expression profiling of osteoarthritic bone suggests altered bone remodelling, WNT and transforming growth factor-β/bone morphogenic protein signalling" pot

Báo cáo y học: "Microarray gene expression profiling of osteoarthritic bone suggests altered bone remodelling, WNT and transforming growth factor-β/bone morphogenic protein signalling" pot

... AAGACAAAGCCAACCGATAC GAAGTTGAACTGCTAGCCTC RUNX2 (NM_004348 ) TGATGACACTGCCACCTCTG GGGATGAAATGCTTGGGAAC S10 0A4 (NM_002961 ) GTCAGAACTAAAGGAGCTGC TGTTGCTGTCCAAGTTGCTC SMAD3 (NM_005902 ) TTCAACAACCAGGAGTTCGC TACTGGTCACAGTA STC1 ... ATGTCACCGTCAGCAACGCA CGGTCTTGATGCTGTTCTTG MT 2A (NM_005953 ) GCAAATGCACCTCCTGCAAG GTGGAAGTCGCGTTCTTTAC NHERF1 (NM_004252 ) TCACCAATGGGGAGATACAG GTCTTGGGAATTCAGCTCCT...
Ngày tải lên : 09/08/2014, 10:21
  • 21
  • 402
  • 0
Báo cáo y học: "The developmental expression dynamics of Drosophila melanogaster transcription factors" pptx

Báo cáo y học: "The developmental expression dynamics of Drosophila melanogaster transcription factors" pptx

... data. These data were compared to the Z scores obtained by randomly sampling 373 genes and repeating this approach 100 times. Gene Ontology analysis Lists of candidate genes were uploaded to FlyMine and GO ... development and physi- ology on a systems level. A potential shortcoming of this approach is that we are considering RNA levels as a proxy for TF activity. Because t...
Ngày tải lên : 09/08/2014, 20:21
  • 14
  • 286
  • 0
Báo cáo y học: "The distinct clinical profile of chronically critically ill patients: a cohort study" pps

Báo cáo y học: "The distinct clinical profile of chronically critically ill patients: a cohort study" pps

... that. Tracheotomy was performed at 16 ± 6 days, and was pre- ceded by 26% of extubation failures, which have been linked to increased mortality when caused by airway-unrelated causes [40]. Tracheal ... Mar a M Aprea 1 , Enrique Laffaire 1 , Victor Gola 1 and Arnaldo Dubin 2 1 Servicio de Terapia Intensiva, Hospital Interzonal General San Martín, La Plata, Buenos Aires, Argentina 2...
Ngày tải lên : 12/08/2014, 23:24
  • 9
  • 507
  • 0
Báo cáo y học: "Capturing real-life patient care in psoriatic arthritis and its risks: the challenge of analysing registry data" docx

Báo cáo y học: "Capturing real-life patient care in psoriatic arthritis and its risks: the challenge of analysing registry data" docx

... Arthritis Research & Therapy Vol 11 No 3 Aletaha Page 2 of 2 (page number not for citation purposes) study by Saad and colleagues, it can serve as a very good example for that: comorbidity ... withdrawal. In summary, the study by Saad and colleagues gives us important insights into daily-life use of TNF inhibitors in PsA, a disease that too often is secondary to RA in th...
Ngày tải lên : 09/08/2014, 14:20
  • 2
  • 291
  • 0
Báo cáo y học: "The long-term prediction of return to work following serious accidental injuries: A follow up study" docx

Báo cáo y học: "The long-term prediction of return to work following serious accidental injuries: A follow up study" docx

... are in line with Lazarus’ theories on stress, appraisal and coping [13,23]. Lazarus emphasized the significance of the primary and secondary appraisal of a stressful situation. In the primary ... primary appraisal the situation can be judged as harmful, as a threat or as a challenge. The same situation can be appraised differ- ently by different individuals. The secondary appr...
Ngày tải lên : 11/08/2014, 15:22
  • 7
  • 299
  • 0
Báo cáo y học: "Differential gene expression of bone anabolic factors and trabecular bone architectural changes in the proximal femoral shaft of primary hip osteoarthritis patients" pptx

Báo cáo y học: "Differential gene expression of bone anabolic factors and trabecular bone architectural changes in the proximal femoral shaft of primary hip osteoarthritis patients" pptx

... GTCAGCCAACTCGTCACAGTCC OPN Sense AGCCGTGGGAAGGACAGTTATG 472 62 29 NM_000582 Antisense GAGTTTCCATGAAGCCACAAAC IGF-I Sense GAGCCTGCGCAATGGAATAAAG 344 62 33 NM_000618 Antisense CCTGTCTCCACACACGAACTG IGF-II Sense GAGGAGTGCTGTTTCCGCAG ... mean ± standard devi- ation (open diamond) and non-parametric median (closed diamond) and quartile (dash) range. COL 1A, collagen type I alpha chain; GAPDH,...
Ngày tải lên : 09/08/2014, 08:23
  • 12
  • 421
  • 0
Báo cáo y học: " Global gene expression patterns in the post-pneumonectomy lung of adult mice" ppt

Báo cáo y học: " Global gene expression patterns in the post-pneumonectomy lung of adult mice" ppt

... PNY and SHAM, and between 3 day and 7 day time points. Results Microarray analysis and validation Microarray data was collected from pooled lung samples (n = 8) at four time points (6 hr, 1 day, ... preparation and RNA isolation The mice were anesthetized as above at 6 hours, 1 day, 3 days and 7 days after surgery (PNY or SHAM) then eutha- nized by cervical dislocation. The pulm...
Ngày tải lên : 12/08/2014, 14:20
  • 15
  • 465
  • 0
Báo cáo y học: "Differential gene expression in anatomical compartments of the human eye" pptx

Báo cáo y học: "Differential gene expression in anatomical compartments of the human eye" pptx

... sig- nature, including subunits for crystallin alpha (CRYAA), beta (CRYBA1, CRYBA4), and gamma (CRYGA, CRYGC). Work by Horwitz and colleagues [32,33] on alpha-crystallins, which are structurally ... uveal melanoma invasion and metastasis. Clin Exp Metastasis 2002, 19:233-246. 7. Yoshida S, Yashar BM, Hiriyanna S, Swaroop A: Microarray analysis of gene expression in the aging hu...
Ngày tải lên : 14/08/2014, 14:22
  • 13
  • 310
  • 0
Báo cáo y học: "Differential gene expression in HIV/SIV-associated and spontaneous lymphomas"

Báo cáo y học: "Differential gene expression in HIV/SIV-associated and spontaneous lymphomas"

... 5’-GGAAGTGTTAGGGTTTGGTTTCT-3’ 60 capn4 5’-CCACAAGCTTTTGTTCTCTCAGTA-3’ 5’-CACAGGTACAGGGGAGAGGTTAC-3’ 60 pub 5’-TACTGACCGAGTGCTGAGACTACT-3’ 5’-GCAATTTGCCATATCAATAAAGAA-3’ 60 Northern blot analysis ... cDNA population of lymphoma h1 as tracer, and the cDNA population of lymphoma h2 as driver; and vice versa, 2) the cDNA population of lymphoma h2 as tracer, and the cDNA p...
Ngày tải lên : 02/11/2012, 11:08
  • 7
  • 415
  • 0

Xem thêm