Báo cáo y học: "Modulation of interleukin-1b-induced inflammatory responses by a synthetic cationic innate defence regulator peptide, IDR-1002, in synovial fibroblasts" docx

... carried out the T-cell isolation, T-cell proliferation, cytokine analysis and MLR and analysis of the data. IE participated in the T-cell proliferation assays and statistical analysis. MB participated ... 20:108-25. 2. Yarbro JW: Mechanism of action of hydroxyurea. Seminars in oncology 1992, 19:1-10. Inayat et al. Journal of Inflammation 2010, 7:43 http://www.journal-inflammation....

Ngày tải lên: 11/08/2014, 06:22

... tissue were clearly provoked. Activation by inflammatory stimuli after antibody transfer to the mice was indicated by increases in leukocyte rolling along and attachment to the venular endothelium ... signalling pathway by inhibitory mechanisms that are as yet unresolved had already been described in other experimental systems in vivo and in vitro [6,13], it was not at all cle...

Ngày tải lên: 09/08/2014, 08:22

... great advantage of gene delivery to the syn- ovial cells is that they contain the enzymatic apparatus to apply post-translational modifications, including the hydroxylation and glycosylation of ... rheumatoid arthritis. Hum Gene Ther 2009, 20:97-101. 20. Takayanagi H, Juji T, Miyazaki T, Iizuka H, Takahashi T, Isshiki M, Okada M, Tanaka Y, Koshihara Y, Oda H, Kurokawa T, Nakamura K, T...

Ngày tải lên: 12/08/2014, 14:22

... NF-kappa B activation induced by various inflammatory agents. J Immunol 1998, 161:2873-2880. 68. Delgado M, Ganea D: Vasoactive intestinal peptide and pitui- tary adenylate cyclase-activating ... activation of other kinases Inhibitory Effects of NE are mediated by β-ARs and replicated by cAMPFigure 4 Inhibitory Effects of NE are mediated by β-ARs and replicated by cAMP. Micr...

Ngày tải lên: 19/06/2014, 22:20

... patients by transoral drainage of deep neck infections, including three cases of para- pharyngeal abscess [4]. Transnasal endoscopic drainage for retroparapharyngeal abscess was reported in two cases ... http://jmedicalcasereports.com/jmedicalcasereports/article/view/7317 Case report Open Access Management of deep neck infection by a transnasal approach: a case report Yuh Baba...

Ngày tải lên: 11/08/2014, 17:21

... years after VBG with an inability to swallow solid food. A gastrographin swallow revealed a dilated dis- tal oesophagus and a lack of oesophagogastric passage. The patient was treated surgically ... morbid obesity in 1995. A month earlier she had been treated medically for aspiration pneumonia. A gastrographin swallow showed an extensive dilatation of the oesophagus with a s...

Ngày tải lên: 11/08/2014, 23:21

... Open Access Modulation of interleukin-1b-induced inflammatory responses by a synthetic cationic innate defence regulator peptide, IDR-1002, in synovial fibroblasts Emily Turner-Brannen 1 , Ka-Yee ... beyond the scope of this article. Interaction of the peptide with putative intracellular protein partners may be facilitating alteration of innate immune sig...

Ngày tải lên: 12/08/2014, 17:22

... C- terminal dimerization domain of cI can be replaced by another protein that homodimerizes, in this instance an inactive variant of PR was used. When bacteria are transformed with a reporter plasmid ... J.S., Tang ,A. H.,Leavitt ,A. D.&Stroud,R.M.(2000)Crystalstruc- ture of the HIV-1 integrase catalytic core and C-terminal domains: a model for viral DNA binding. Proc. Natl...

Ngày tải lên: 08/03/2014, 09:20

... (5¢-CAT ATGGGAATTGATGCTTCTGATTAC-3¢;5¢-GAATTC TGGAATCCAGTCGACATTCAG-3¢), a 0.9-kb fragment was generated containing the catalytic domain of the enzyme (amino acids 442–731 of human PEP). This fragment was cloned into pPCR-Script Cam (Stratagene). The ... three-dimensional structure of PEP revealed a two-domain organization [4]. The catalytic domain displays an a/ b hydrolase fold...

Ngày tải lên: 31/03/2014, 08:20

... CCTAGCTCATCTCCAAA- GAG; CCL3, forward ATGCAGGTCTCCACTGCTGC, reverse TCAGGCACTCAGCTCCAGGTC; CXCL10, for- ward AAGGATGGACCACACAGAGG, reverse ACCCTT- GGAAGATGGGAAAG. Control primers for human β-actin were ... Software (LabVelocity, San Francisco, CA, USA), were: β-actin, AGAAAATCTGGCAC- CACACC; CCL5, AACCCAGCAGTCGTCTTTGT. Densit- ometry analysis was performed using the Bio-Rad FX imager (Bio-Rad...

Ngày tải lên: 09/08/2014, 07:20