Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

... stable and are easily a ordable. It may also be useful to test the eff ect of EGCG or GTPs in combination with other phytochemicals that have anti-infl ammatory activi- ties. Additionally, GTPs ... anakinra, to antagonize IL-1 (IL-1α and IL-1β) activity is a US Food and Drug Administration approved therapy for the treatment of rheumatoid arthritis but not for OA due to it...

Ngày tải lên: 12/08/2014, 17:22

2 338 0
báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

... that can capture the information in each of the negatives of a large collection before the damage causes a complete and irretrievable loss of information. 2.1. Restoration Approaches. The primary ... overall restoration accuracy of the system. Moreover, we plan to perform a digital restoration on a deteriorated photonegative and then perform a physical restoration...

Ngày tải lên: 21/06/2014, 20:20

13 569 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

... alkalinization, hy- dration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy. [25] Anyway, we may have favourable issues by changing the dose of ras- buricase, according ... laboratory data: hyperuricemia, hyper- kalemia, hyperphosphatemia, and secondary hypo- calcemia as described by Cairo- Bishop criteria. [1] According to these criteria, the levels of t...

Ngày tải lên: 31/10/2012, 14:59

11 716 0
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx

Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx

... usually bind multiple ligands and vice versa, one may anticipate that blockade of one ligand or receptor may be compensated for by other members of the superfamily. In addition, some ligands may ... rejection and inflammatory bowel disease [4]. Analysis of synovial tissue, synovial fluid and peripheral blood from patients with rheumatoid arthritis (RA) revealed abundant expression...

Ngày tải lên: 09/08/2014, 01:23

5 460 0
Báo cáo y học: " Histone deacetylases — a new target for suppression of cartilage degradation" pdf

Báo cáo y học: " Histone deacetylases — a new target for suppression of cartilage degradation" pdf

... DNA. In the case of H3 and H4, specific lysine sidechains undergo acetylation, through the action of histone acetyltransferases, by way of acetyl coenzyme A, a step which is associated with transcriptional ... dinucleotide) as a cofactor [5]. The members of family II are of particular importance because they are modular proteins with binding domains for protein–protein...

Ngày tải lên: 09/08/2014, 06:23

2 398 0
Báo cáo y học: "Cia5d regulates a new fibroblast-like synoviocyte invasion-associated gene expression signature" pptx

Báo cáo y học: "Cia5d regulates a new fibroblast-like synoviocyte invasion-associated gene expression signature" pptx

... Nakamura K, Tokunaga Y, Hanada S, Kumemura H, Maeyama M, Harada M, Ogata H, Yano H, Kojiro M, Ueno T, Yoshimura A, Sata M: Spreds, inhibitors of the Ras/ERK signal transduction, are dysregulated ... used for cluster analysis and generation of a heat map. Quantitative real-time PCR The same RNA used for the microarray experiments was also used for the quantitative real-t...

Ngày tải lên: 09/08/2014, 10:23

14 337 0
Báo cáo y học: "Green tea polyphenol extract attenuates lung injury in experimental model of carrageenan-induced pleurisy in mice" ppt

Báo cáo y học: "Green tea polyphenol extract attenuates lung injury in experimental model of carrageenan-induced pleurisy in mice" ppt

... STAT-1. Signal transducers and activators of transcription (STAT) factors are a family of cytoplasmic transcription factors that mediate intracellular signaling initiated at cytokine cell surface ... excellent tech- nical assistance during this study, Mrs Caterina Cutrona and Deborah A. Schaller for secretarial assistance and Miss Valentina Malvagni for editorial assistance with...

Ngày tải lên: 12/08/2014, 18:21

13 355 0
Báo cáo y học: "Nebulised heparin: a new approach to the treatment of acute lung injury" pdf

Báo cáo y học: "Nebulised heparin: a new approach to the treatment of acute lung injury" pdf

... without the risk of systemic complications? What is the adequate duration of this therapy? Does the underlying cause of ALI make any difference with regard to this approach? Ultimately, randomized controlled ... begins in the early phases of ALI, how can it be assessed in order to initiate heparin administration as rapidly as necessary? How can dosage of the drug be titrat...

Ngày tải lên: 13/08/2014, 11:22

2 350 0
Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx

Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx

... proportion of the ICS dose that is absorbed orally increases the potential forsystemicsideeffects,itis advantageous for the oral bioavailability of an ICS to be relatively low. The oral bioavailability ... AAhmet@cheo.on.ca 1 University of Ottawa, Children’s Hospital of Eastern Ontario, Ottawa, Ontario, Canada Full list of author information is available at the end of...

Ngày tải lên: 08/08/2014, 21:20

12 774 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... arteries, abdominal situs inversus, bilateral (a) t TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGG...

Ngày tải lên: 09/08/2014, 23:20

36 447 0
w